ID: 1061149025

View in Genome Browser
Species Human (GRCh38)
Location 9:128818599-128818621
Sequence CAGCAGCCCTGTGCCCTCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061149014_1061149025 29 Left 1061149014 9:128818547-128818569 CCCTTGGCAGTGTTTGTGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1061149025 9:128818599-128818621 CAGCAGCCCTGTGCCCTCGTTGG 0: 1
1: 0
2: 0
3: 27
4: 207
1061149016_1061149025 28 Left 1061149016 9:128818548-128818570 CCTTGGCAGTGTTTGTGAGTGGA 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1061149025 9:128818599-128818621 CAGCAGCCCTGTGCCCTCGTTGG 0: 1
1: 0
2: 0
3: 27
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061149025 Original CRISPR CAGCAGCCCTGTGCCCTCGT TGG Exonic
900132228 1:1092018-1092040 CATCAGCCCTTTGCCCGCCTGGG + Exonic
900148657 1:1168896-1168918 CAGCTGCCCTGATCCCTCCTGGG - Intergenic
900339164 1:2179729-2179751 CAGCAGCCCTGGGCCCGGGGTGG - Intronic
900407282 1:2498262-2498284 CAGAAGCCATGTGACCTCCTCGG + Intronic
900469928 1:2848785-2848807 CTGGAGCCCTGTGCCCTGGGTGG + Intergenic
901004763 1:6166373-6166395 CTGCAGCCCTGGGCTCTCCTGGG - Intronic
901415076 1:9110982-9111004 CAGCAGCCCTGTGCCCCCACAGG + Intronic
903034940 1:20486919-20486941 CTGCCGCCCTCTGCCCTCGGGGG + Intergenic
904264879 1:29312619-29312641 CAGCAGCCCCGTGGCATGGTAGG - Exonic
904697507 1:32338413-32338435 CAGCAGCCCCATGGCCTCCTCGG + Intergenic
904826236 1:33275762-33275784 CAGCAGCCTGGGGCCCTCCTGGG + Intronic
906796275 1:48698581-48698603 CAGCAGCCCTGTGTACTTGTGGG + Intronic
907304386 1:53505683-53505705 CAGAAGCCCTGTGCCCACCCTGG - Intergenic
911102442 1:94105388-94105410 CAGCAGCCCTGTCTCCTGGGTGG - Intronic
913011474 1:114687945-114687967 CAGCAGCCATTTGCCCACTTTGG + Intronic
915553344 1:156647567-156647589 CAGGAGGCCTGTGCCCGCATTGG + Exonic
917981322 1:180271544-180271566 CAGCACTCCTGTGCCCTCCGGGG + Intronic
918802136 1:188985997-188986019 CTGCAGCTCTGTGCCCTTGATGG + Intergenic
919653987 1:200180153-200180175 CAGCAGCCCCCTGTCCTCGGTGG + Intergenic
920344618 1:205298364-205298386 CAGCTGCCTTGGGCCCTCCTTGG - Intergenic
924319984 1:242839110-242839132 CACCAGCCCTTTGCCCTCGCTGG + Intergenic
924740175 1:246790247-246790269 CAGCAGCCCTCTCCCCTCCCTGG - Intergenic
1064543412 10:16427657-16427679 CAGAAACCCTGTACCTTCGTAGG - Intergenic
1065100351 10:22325526-22325548 CCCCAGCGCTGTGGCCTCGTGGG + Intronic
1069613708 10:69792679-69792701 CATCTGCCCTGTTCCCTCGGGGG + Intergenic
1070786772 10:79166528-79166550 CAGCTGCCCTGTACCGTCCTGGG + Intronic
1073864391 10:107785128-107785150 CAGCAGCCTTGTCCCTTCTTTGG + Intergenic
1074971952 10:118546045-118546067 CTGCAGCTCTGTGCCATCATGGG - Intergenic
1075122404 10:119673548-119673570 CAGCAGCCCTGGGCCCCCTGTGG + Intronic
1075655098 10:124156103-124156125 CACCAGAGCTGTGCCCTCGCAGG - Intergenic
1076934316 10:133557198-133557220 CCCCAGCCCAGTGCCCTCCTGGG - Intronic
1077224237 11:1433165-1433187 CAGCTGCCCTGTGCCCTTGGTGG + Intronic
1077430961 11:2515807-2515829 CAGCAGCCCTCGGCCCTGGGGGG + Intronic
1077444299 11:2583171-2583193 CAGCAGGCCTGGCCCTTCGTGGG + Intronic
1078767583 11:14313701-14313723 CAGCAGCCCTTTGTGCTCCTTGG - Intronic
1081170976 11:39869932-39869954 CAGCAGCCATGTGTCCTCTGTGG + Intergenic
1081334092 11:41842738-41842760 CAGCTGCCCTCTGCCATCGAGGG - Intergenic
1081695384 11:45105800-45105822 CAGAAGCCCTCTGCTCTAGTGGG + Intronic
1083446069 11:62708740-62708762 CATCACCCCTGTGCCCACTTCGG + Exonic
1084410307 11:69002869-69002891 CTCCAGCCCTGAGTCCTCGTGGG - Intergenic
1084716489 11:70877520-70877542 CAGCAGAACTCTGCCCTCTTGGG + Intronic
1085618528 11:78020408-78020430 CAGCAGAACTGTCCCCTGGTAGG - Intronic
1085706300 11:78789302-78789324 CCGCAGCCCTGTCCTCACGTGGG - Intronic
1089559537 11:119336894-119336916 CAGAGCCCCTGTGCCCTGGTAGG + Exonic
1090365107 11:126198871-126198893 CAGCAGCTCCTTGCCCACGTAGG - Intergenic
1091447019 12:549699-549721 CAGCAGCCCACTGCCCTTGAAGG - Intronic
1101343040 12:103860001-103860023 CTGAAGCCCTGGGCCCTGGTGGG + Intergenic
1103016076 12:117495599-117495621 CAAAAGCTCAGTGCCCTCGTGGG - Intronic
1104986583 12:132600920-132600942 CAGCAGCACTGTGCGCTAGAGGG - Intergenic
1106185348 13:27404933-27404955 CCTCAGCCCTGTGCCCACGAGGG - Intergenic
1106798682 13:33233642-33233664 CACCAGCCCTTTGCCCTTGTTGG + Intronic
1110190921 13:72727873-72727895 CACAAGCCCCGTGCCCTGGTTGG + Intronic
1113746594 13:112749672-112749694 CAGCAGACGTGTCCCCACGTGGG - Intronic
1113746612 13:112749765-112749787 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746651 13:112749952-112749974 CAGCAGGCATGTCCCCACGTGGG - Intronic
1113746671 13:112750046-112750068 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746690 13:112750139-112750161 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746709 13:112750232-112750254 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746728 13:112750325-112750347 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746746 13:112750418-112750440 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746764 13:112750512-112750534 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113746782 13:112750605-112750627 CAGCAGGCGTGTCCCCACGTGGG - Intronic
1113955559 13:114098520-114098542 CTGCAGCCCTGAGACCTGGTGGG + Intronic
1114724648 14:24922599-24922621 CAGCATCCCTGTGTACTTGTAGG - Intronic
1118764401 14:68900143-68900165 CAGCAGCCCTGTTCCCTGCCTGG - Intronic
1119968329 14:78941828-78941850 TAGCACCCCTGTGCCATCTTTGG + Intronic
1121842878 14:97149484-97149506 CAGCACCCCTGAGCCTGCGTGGG + Intergenic
1122263940 14:100538133-100538155 CAGCAGCCCTGAGCCCGAGCAGG - Exonic
1122264884 14:100541909-100541931 CAGCAGCCCCGGGCCCTGGGTGG - Intronic
1122688265 14:103520213-103520235 CCGCAGCCCGGTGCCCAGGTTGG + Exonic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1127730859 15:61800807-61800829 CTGCAGCCCAGTACCCTTGTGGG - Intergenic
1127785301 15:62350370-62350392 CAGCTGCCCTGCGACCTCCTTGG - Intergenic
1128476048 15:67997545-67997567 CAGCAGCCCTGTCACTTCTTTGG - Intergenic
1129831424 15:78673586-78673608 CAGCATCCCTGTGTCCTGATTGG + Intronic
1132787058 16:1662879-1662901 AAGAAGCCCTGTGTCCTGGTTGG - Intronic
1133038939 16:3049706-3049728 CAGCTTCCCTGGGCCCTGGTGGG - Intronic
1134014415 16:10878574-10878596 CAGGGGCCATGTGCCCTCGGAGG + Intronic
1134020758 16:10919922-10919944 CAGAAGTCCTGTACCCTCCTGGG - Intronic
1134078540 16:11309011-11309033 CAGGAGCCCTGCCCCCTCCTGGG - Intronic
1135471660 16:22736679-22736701 CAGCATCAATCTGCCCTCGTTGG + Intergenic
1137262608 16:46843821-46843843 CTGCAGCCCTGTGCCCAGGTTGG + Intergenic
1137500776 16:49010376-49010398 CAGCAGCCCTGGCCCTTGGTGGG + Intergenic
1140449508 16:75059130-75059152 CAGCTACCCTTTGCCCTTGTAGG + Intronic
1141564719 16:84893544-84893566 CAGCAGACCTCTGCCGTCATGGG + Intronic
1141981088 16:87550883-87550905 CTGCAGCCCTGGGCCGTCCTGGG + Intergenic
1142049563 16:87949539-87949561 CTCCAGCCCTGTGGCCTCGCTGG + Intronic
1143359642 17:6358459-6358481 CAGCAGTCCTGTGTCATTGTTGG - Intergenic
1143770146 17:9163272-9163294 CCGCAGCCCTGCACCCTTGTAGG - Intronic
1143900493 17:10170840-10170862 CAGCAGCTCTGTCACCTCGGAGG + Intronic
1146287289 17:31582440-31582462 AAGCAGCCTTGGGCCCGCGTGGG + Intergenic
1151665393 17:75542687-75542709 CAGCTTCCCTGTGCGCTCATGGG - Intronic
1151850621 17:76687683-76687705 AAGCAGGCGTGTGCCCTCCTGGG + Intronic
1152506677 17:80754089-80754111 CAGCAGCTCGGTGGCCTCGCAGG - Exonic
1152706727 17:81847440-81847462 CAGCAGCCCTGCCCTCCCGTGGG + Intronic
1152759870 17:82102167-82102189 CAGCACCCCTGCCCCCTCCTGGG - Intronic
1152759883 17:82102203-82102225 CAGCACCCCTGCCCCCTCCTGGG - Intronic
1152854874 17:82659006-82659028 CAGCAACCCTGGGCCCTCCCTGG - Intronic
1160226323 18:77014276-77014298 CAGCGGCCATGTGCCCTCAAGGG + Exonic
1160765179 19:804462-804484 CAGCAGCCCGGGGACCTCGGGGG + Intronic
1160835186 19:1121653-1121675 CAGCATCCCAGGGCTCTCGTCGG - Intronic
1160872472 19:1283525-1283547 AAGAAGCCCTGTTCCCTCCTGGG - Intergenic
1164541144 19:29122381-29122403 CAGCAGTCCTGTCTCCTGGTGGG - Intergenic
1164586775 19:29480675-29480697 CAGCAGCCCTGACCCCTCCGGGG - Intergenic
1164829549 19:31310018-31310040 CAGTAGCCTGGTGCCCTCGGAGG + Intronic
1167351531 19:48978062-48978084 CCTCAGCCCTGTGCCCTCCTAGG - Intronic
1168339592 19:55615509-55615531 CAGCTGCCCTGCGCCCTGGCCGG + Exonic
925259977 2:2520635-2520657 CAGCAGCTCTTTGTCCTCGGAGG + Intergenic
925338734 2:3117927-3117949 CTGGAGCCCTGTGCCCTGGCAGG - Intergenic
928403531 2:30996595-30996617 CAGCAGCCTCGGGCCCTCTTGGG - Intronic
929658580 2:43758936-43758958 CAGCAGCACTGTGTCCCCGGAGG - Exonic
931704704 2:64937777-64937799 CAGCAGCTCTGTGCTCTCAGTGG - Intergenic
932239442 2:70145345-70145367 CATCAGCCCTGTGGCTTTGTGGG - Intergenic
932570075 2:72933971-72933993 AAGCAGCACTCTGCCCTCGTGGG - Exonic
933475940 2:82790594-82790616 CACCGGCCCTTTGCCCTCGCTGG - Intergenic
934958883 2:98649645-98649667 CTGCAGCACTGTGGCCTTGTTGG - Intronic
935830939 2:107000132-107000154 CACCAGCCCTTTGCCCTGGCTGG + Intergenic
937771010 2:125721042-125721064 CACCAGCCCTTTGCCCTTGCTGG + Intergenic
937907174 2:127058049-127058071 GGGCAGCCCTGTGCCCTGGGAGG - Intronic
938135850 2:128755871-128755893 CAACAGCTCTGTGCCCCGGTAGG + Intergenic
938370036 2:130763027-130763049 CAGCAGCAGCGTGCCCTCCTAGG + Exonic
941771554 2:169350804-169350826 CAGCAGCCTGGGGCCCTCTTTGG + Intronic
943295136 2:186128814-186128836 CAGCAGCCCTGTGCCCCACAGGG - Intergenic
943961104 2:194264815-194264837 CAGCACCCCTGTGCCCTTGGGGG + Intergenic
948168180 2:235879057-235879079 CAGCAGCCCAGTGTCCTGGCAGG + Intronic
1169045297 20:2530197-2530219 CAGCAGCCCGGTGCCCAGGTAGG + Intergenic
1170155533 20:13265773-13265795 CAGTAGCAATGTGCCCTCTTGGG - Intronic
1171469163 20:25356267-25356289 AAGGAGCCCTGTGCCCCCGTGGG - Intronic
1172664715 20:36591142-36591164 CAGCAGCCCCTTTCCCACGTGGG + Exonic
1174354948 20:49991244-49991266 CAGCACACCTGAGCCCTAGTGGG + Intergenic
1174780208 20:53382538-53382560 CAGCTGCTCTGTGCTCTCTTTGG - Intronic
1175882571 20:62269425-62269447 AAGCAGCCCAGTCCCCTCGTGGG + Intronic
1175961320 20:62638041-62638063 CAGCAGCCCTGTCCACACCTGGG - Intergenic
1176077089 20:63253644-63253666 CCGGAGCCCGGTGCCCTCGGGGG - Intronic
1176219005 20:63961247-63961269 CCCCAGCCCTGTCCCCTCCTGGG + Intronic
1176276916 20:64277929-64277951 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1176276939 20:64278013-64278035 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1179553069 21:42155544-42155566 CTGCGGCCCTGTGTCCTAGTTGG - Intergenic
1179642444 21:42756546-42756568 CCACAGCCCTGGGCCCTCGGAGG - Intronic
1179642458 21:42756593-42756615 CCACAGCCCTGGGCCCTCGGAGG - Intronic
1179642472 21:42756640-42756662 CCACAGCCCTGGGCCCTCGGAGG - Intronic
1180077094 21:45468437-45468459 CAGCACCCCTGGGCCCTCTGTGG - Exonic
1183597563 22:38821896-38821918 CTGCAGCCCTTTGGCCTCCTGGG + Exonic
1183689108 22:39378170-39378192 CAGGAGCCCTGTGACATCCTCGG - Intronic
1183987278 22:41576510-41576532 CATCAGCCCTGGGGCCTCCTGGG + Exonic
1184037652 22:41926302-41926324 CAGCAGCCCTGCGCCCAGGACGG - Exonic
1184230983 22:43158319-43158341 CCCCAGCCCTGTGCCCCCCTGGG + Intronic
1184458109 22:44622829-44622851 CAGGAGCCCAGTGCCCACCTGGG - Intergenic
1184967930 22:47995266-47995288 CAGCAGGCCTGTGGCCCCGTGGG + Intergenic
1185066840 22:48636703-48636725 CAGCAGCCCTGGGGGCTCCTGGG - Intronic
950421163 3:12900820-12900842 CACCAGCCCTGTGGGCTCCTGGG + Intronic
950484932 3:13267563-13267585 CCCCAGCCCTGTGCCCTTCTGGG + Intergenic
950499390 3:13354190-13354212 CAGCTGCCCTGTGGGCTCTTGGG + Intronic
950739754 3:15040863-15040885 GAGCAGGCCTGTGGCCTCCTAGG - Intronic
951927883 3:27929101-27929123 CAGCAGCCATGTTCCTTTGTTGG - Intergenic
954105315 3:48406700-48406722 CAGCAGCCCTGTGAGCTGGTTGG - Intronic
954411051 3:50371254-50371276 CAGCAGCCCTATGCCCTCTCTGG - Intronic
957304701 3:78441970-78441992 CAGCACCCATGTGCACTCTTTGG + Intergenic
957417769 3:79929005-79929027 CAGCATCCCTGTGCTCTCAGGGG + Intergenic
957613955 3:82505349-82505371 AGGCATCCCTGTGCCCTCGGGGG + Intergenic
959988998 3:112609995-112610017 CAGCAGCTCTCTGCCCTCAGTGG - Exonic
960146978 3:114213880-114213902 AAGCAGGCCTGCCCCCTCGTGGG - Intergenic
961451477 3:127004165-127004187 CAGCATCCCAGTGCCCACGGAGG - Intronic
961654515 3:128433718-128433740 CCGCAGCTCAGGGCCCTCGTGGG + Intergenic
967814523 3:193787768-193787790 CATCAGCCCTGTAACCTCATGGG - Intergenic
968107910 3:196015339-196015361 CAGCAACCCTGTGGCCTCAAGGG - Intergenic
968649651 4:1755460-1755482 CCGGGGCCCTGTGGCCTCGTGGG - Intergenic
968660882 4:1798242-1798264 CAGCAGCCCTGGCCCCTCCCTGG - Intronic
969482958 4:7456607-7456629 CAGCAGCTCTGTCCCCACCTGGG + Intronic
972665164 4:41158199-41158221 CAGCAGCCCTGTGAGTTAGTTGG - Intronic
973022426 4:45220247-45220269 CACCAGCCCTTTGCCCTCACTGG - Intergenic
976274015 4:83257991-83258013 CTGCAGCCTTCTGGCCTCGTTGG - Intergenic
984296550 4:177861647-177861669 CAGGATCCCTGTGCTCTCGGGGG + Intronic
984754681 4:183314111-183314133 CAGCAGCAGTGTGCCTTAGTGGG + Intronic
985469849 5:33406-33428 CAGCAACCCTGTGGCCTCAAGGG - Intergenic
985667122 5:1187077-1187099 CAGGAGCCCTGTGGCCCCGCTGG + Intergenic
985700792 5:1371205-1371227 TAGAAGGCCTGTGCCCTCCTTGG + Intergenic
985714677 5:1448647-1448669 CTGCACCCCTGTGCCCTCCCCGG + Intergenic
985790489 5:1924356-1924378 CAGGAGCCCAGTGCCTTCTTGGG + Intergenic
987644121 5:20647702-20647724 CAGCAGCCCCATCCCCCCGTGGG + Intergenic
989209653 5:38846276-38846298 CAGCAGCCCGTTCCCCTCCTCGG + Exonic
990606726 5:57417670-57417692 CAGCAGACCTCTGACCTGGTGGG - Intergenic
995527231 5:113059786-113059808 CAGCAGGCCTGTAGCCTGGTGGG + Intronic
997429914 5:133830440-133830462 CCCCAGCCCTGTGCCCTTGTTGG - Intergenic
999709337 5:154302503-154302525 CATCAGCCCTGTGCTCTGGAGGG - Intronic
1002292848 5:178211405-178211427 CAGCAGGCATGTCCCCTCCTGGG + Intronic
1002770907 6:290397-290419 CTGCAGCCTTCTGCCCTCCTTGG - Intergenic
1002797683 6:488084-488106 CAGCTGCCATGTGCCCACGTGGG + Intronic
1003879403 6:10466484-10466506 CAGCAGCCGTGTGCCCTTCTCGG + Intergenic
1005026449 6:21467084-21467106 CACCAGCCCTTTGCCCTCACTGG + Intergenic
1007239059 6:40412025-40412047 CAGCAGCCCTATGACCTGGATGG - Intronic
1007363315 6:41373465-41373487 CAGGAGCCCGGTGGCCTCGAGGG - Intergenic
1008085106 6:47236105-47236127 CAGTAGCTGTGTGCCCTCTTTGG - Intronic
1008248106 6:49203924-49203946 CATCAGCCCTTTGCCCTTGTTGG + Intergenic
1012925234 6:105260924-105260946 CTGCAGCACTGTGCCCTAGAAGG + Intergenic
1014186972 6:118445782-118445804 CAGCAGCCCTGTGCTGTAGGAGG - Intergenic
1015833111 6:137390531-137390553 CGGCAGCCCTGTGTCCTCCAGGG + Intergenic
1016876780 6:148873416-148873438 CAGCAGCCCTTTGTCCTCGATGG + Intronic
1017175013 6:151494301-151494323 GAGCAGCTCTGTGCCCGCGAGGG + Intronic
1018872226 6:167791995-167792017 CAGCAGCCCTGAACCCTCTGCGG + Intronic
1019426153 7:977782-977804 CTGCAGCCCTGGGCCCTCCTTGG - Intergenic
1019604139 7:1900066-1900088 CAGCGGCCCTGCGCTCTCGGCGG - Intronic
1026524390 7:71141622-71141644 GAGCAGCCCTGGGCCATGGTAGG + Intronic
1027616827 7:80434035-80434057 CACCAGCCCTTTGCCCTCATTGG + Intronic
1028046823 7:86130711-86130733 CACTGGCCCTGTGCCCTCGCTGG - Intergenic
1029116139 7:98238265-98238287 CAGCACCCCTGTGCACTAGCAGG + Intronic
1029986939 7:104931138-104931160 CAGCAGTCCTGTGCCCTCCGAGG - Intergenic
1030143342 7:106327724-106327746 CAGCAGCCCTGAGCTCTCCTGGG + Intergenic
1030310427 7:108063622-108063644 CAACAGCCCTGTCACCTAGTGGG + Intronic
1030540935 7:110830011-110830033 CCCCAGCCCTGTTCCCTCATTGG - Intronic
1031887352 7:127255311-127255333 CAGCAGCCTGGTGCTCTAGTGGG + Intergenic
1033101994 7:138481733-138481755 CTGCAGCCCTGGGTCCTCCTGGG - Intronic
1035297500 7:157875728-157875750 CTGCAGCCCCGTGCCCCCCTGGG - Intronic
1037770271 8:21794853-21794875 CAGCAGCCCTGTTCATTCTTTGG - Intronic
1042753581 8:72184960-72184982 CATCAGCCCTGTGCCCCTCTAGG + Intergenic
1043687580 8:83107030-83107052 CACCAGCCCTTTGCCCTCGCTGG + Intergenic
1048450864 8:134532859-134532881 CAGCTCCCCGGTGCCCACGTTGG + Exonic
1049416692 8:142498687-142498709 CAGCGGCCCTGGGCCCTTGCTGG - Intronic
1049507986 8:143013963-143013985 CAGCTGCCCTGTGTGCTCCTAGG - Intergenic
1055079709 9:72257247-72257269 CGGCAGCCCTGGGGCCTCGTGGG - Intergenic
1056773323 9:89495419-89495441 CAGCAGCCCTGGACCCTGGACGG + Intronic
1057804494 9:98210733-98210755 CAGCAGCTCTGAGCACTCGCTGG + Exonic
1057883443 9:98809866-98809888 CAGCTGCCCTGTGTCCTCTCAGG + Intronic
1060656345 9:125375000-125375022 CAGGAGCCCCCTGCCCTCCTGGG - Intergenic
1061149025 9:128818599-128818621 CAGCAGCCCTGTGCCCTCGTTGG + Exonic
1061911514 9:133727674-133727696 CAGCAGCTCTGAGACCTGGTAGG - Intronic
1062165628 9:135105963-135105985 AAGCCGCCCTGAGCCCTCGGGGG + Intronic
1062460668 9:136661359-136661381 CAGCCGCCCTGTGCCTCCCTCGG - Intronic
1062685255 9:137809407-137809429 CGGCGGCCCTGCGCCCTCGGAGG + Intronic
1062733737 9:138123021-138123043 CAGCTGCCCTGTGGCTTCCTTGG - Exonic
1192497101 X:71623251-71623273 CTGCAGCTCTGAGCCCTCCTGGG + Intergenic
1193485433 X:82080563-82080585 CACCAGCCCTTTGCCCTTGTGGG - Intergenic
1197272736 X:124443287-124443309 CAGCAGACCTCTGCCTTCCTTGG - Intronic
1197701772 X:129605184-129605206 CAGGAGCCCTGTGCCCTGCCAGG + Intergenic
1198126299 X:133647365-133647387 TAGCACCCCTGTGCCCTTGCTGG - Intronic