ID: 1061149101

View in Genome Browser
Species Human (GRCh38)
Location 9:128818847-128818869
Sequence CCCGGGCCGCGGGGTCCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061149101_1061149112 3 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149112 9:128818873-128818895 GCTGGCCAAGTACGGGCTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 170
1061149101_1061149116 9 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149116 9:128818879-128818901 CAAGTACGGGCTGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1061149101_1061149111 -4 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149111 9:128818866-128818888 CGGGCGAGCTGGCCAAGTACGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1061149101_1061149110 -5 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149110 9:128818865-128818887 CCGGGCGAGCTGGCCAAGTACGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061149101_1061149113 4 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149113 9:128818874-128818896 CTGGCCAAGTACGGGCTGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1061149101_1061149114 5 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149114 9:128818875-128818897 TGGCCAAGTACGGGCTGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061149101 Original CRISPR CCCGGGCCGCGGGGTCCCCC GGG (reversed) Exonic
900091845 1:924148-924170 CCAGGGCCTCGGGGCTCCCCGGG - Intergenic
900227606 1:1540379-1540401 CCCCGGCCCCGGCGCCCCCCCGG + Intronic
900298830 1:1966439-1966461 AGCTGGCCCCGGGGTCCCCCTGG + Exonic
900516662 1:3085418-3085440 CCTGGGCAGCAGGGCCCCCCAGG + Intronic
901871556 1:12141634-12141656 CCCGGACCGAGGGGACTCCCAGG + Intronic
903115482 1:21176104-21176126 CCTGGGCTGCGGGGTCCCCCTGG + Intronic
904045191 1:27604294-27604316 CCCCAGGCGCGGGGTCCCCGGGG - Intronic
904208829 1:28872343-28872365 CCCGGGCAGCCTGGTCGCCCTGG - Intergenic
904611988 1:31731031-31731053 CCCGGCCGGAGGGGACCCCCCGG - Exonic
904746128 1:32712348-32712370 CCCGGGGCGCGGGGTCGGCGTGG - Intergenic
904902127 1:33865636-33865658 CCTGGACTGCGGTGTCCCCCAGG - Intronic
905168677 1:36098089-36098111 CCCGGGCCCCCGGGACCCCCTGG - Exonic
905168937 1:36098758-36098780 CCAGGGACCCGGGGCCCCCCTGG - Exonic
905169026 1:36099004-36099026 CCAGGGCAGGGGGGTGCCCCCGG - Exonic
905169195 1:36099406-36099428 CCCGGGCCTCGGGGTCCCCCTGG - Exonic
905202409 1:36323421-36323443 CCCGGGCCGGTGGGTCCCCGCGG - Intronic
906073652 1:43036004-43036026 CCCTGGCCCCTAGGTCCCCCCGG + Intergenic
906197180 1:43936402-43936424 CCCGCGCCGCGCGGCCCCCGCGG - Exonic
908356677 1:63329741-63329763 CCCAGGCAGCGGGGAGCCCCAGG - Intergenic
910693144 1:89984880-89984902 CCCGGGCCGGTGGGTCCGGCTGG + Intergenic
914899492 1:151704186-151704208 CCTGGGCTGGGGGGGCCCCCAGG + Intronic
916066621 1:161141190-161141212 CAGGGGCCGCGGCCTCCCCCCGG - Intergenic
920331567 1:205211772-205211794 CCCTCGCCGCGGGGTCTCCTGGG + Intergenic
920741673 1:208586711-208586733 CCCTGGCCTCAGGCTCCCCCAGG - Intergenic
923712700 1:236399861-236399883 CCCAGGCCCAGGGTTCCCCCAGG - Intronic
924421877 1:243917352-243917374 CCCCGGCCTCGGGGGCCCGCGGG - Intergenic
924778348 1:247126643-247126665 CCCGGGCCCCGGGCTCCCAGCGG + Intronic
924783310 1:247171777-247171799 CCCGGGCCCCGGGCTCCCAGCGG - Intronic
1062873876 10:930939-930961 CGCGGGCCGCGAGCGCCCCCAGG - Intronic
1062935485 10:1382954-1382976 CCCAGGCCACTGCGTCCCCCAGG - Intronic
1064060066 10:12129747-12129769 CCGAGGCCGCGGTTTCCCCCTGG + Exonic
1064167801 10:13001610-13001632 CCCGGGCCGGCGGGCTCCCCGGG - Exonic
1067071894 10:43138515-43138537 CCTGCGCCGCGGGGACACCCGGG - Exonic
1067694420 10:48524437-48524459 GCCGGGCCGCGCGCTCTCCCAGG + Intronic
1069749704 10:70737312-70737334 ACCCAGCCACGGGGTCCCCCGGG - Intronic
1072253635 10:93600883-93600905 CCTGGGCCGCCTGGGCCCCCTGG + Intronic
1072976726 10:100065352-100065374 CCCGGGTCTCGGGTTCCACCTGG + Exonic
1073460091 10:103661229-103661251 CCCCGGCTGCGGGCTGCCCCTGG - Intronic
1073509463 10:104034271-104034293 CCTGGGCCGCAGGGACCCCCTGG - Exonic
1073509556 10:104034698-104034720 CCAGGGCCTCGAGGGCCCCCGGG - Exonic
1074815255 10:117137589-117137611 CCCGGTCAGCGGGGCCCCTCCGG + Intronic
1075885543 10:125896356-125896378 GCGGGGCCGCGGGGGCCGCCAGG + Intronic
1076613960 10:131744053-131744075 CCAGGGCAGCTGGGGCCCCCTGG + Intergenic
1076687576 10:132204969-132204991 CCGAGGCCGCGGGGGCCCCAGGG + Exonic
1076885771 10:133261767-133261789 CCCCTGCCGCGGGGGCCCCTCGG + Intergenic
1076915921 10:133423172-133423194 CCCGGCCCGCGCCATCCCCCAGG - Exonic
1076918688 10:133440254-133440276 CCGGGGCAGCCGGGTCACCCTGG + Intergenic
1076936062 10:133568039-133568061 CCCGGGCCGCACCGTCCCCCAGG - Intronic
1077008546 11:370042-370064 CGCGGGCGGCGGGGGCCCCGGGG + Intronic
1077010306 11:376568-376590 CCCGGGACGGGGGGACCCCCAGG + Exonic
1077016257 11:400286-400308 CCCGGGATGCGGGGTCCCTGGGG + Intronic
1077095770 11:798399-798421 CCCTGGCCGTGGGTTCCCCCGGG + Exonic
1077146585 11:1049227-1049249 CCCCCGCCGTGGGGTCACCCTGG + Intergenic
1077185090 11:1232225-1232247 CCTGGGCCACGGGGACCCCTGGG + Intronic
1077386019 11:2269864-2269886 CCCGGGCCGCGGGGGCAGCTCGG - Exonic
1077630572 11:3808598-3808620 CCCGGGCCACCTGGGCCCCCGGG + Exonic
1078255137 11:9652353-9652375 CCCTGGCCACTGGGTCCCCCTGG - Intergenic
1078334229 11:10451083-10451105 CCTGGGCCGCAGGGTCCGCGGGG - Intronic
1079423559 11:20317828-20317850 CCCGGGCCGTGAGGTCACCTGGG + Intergenic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1080283896 11:30586432-30586454 GCAGGGGCGCGGGGTCCCGCCGG - Intronic
1081967575 11:47178893-47178915 CCCAGTCCCCGGGGTCCCCAGGG - Exonic
1083661287 11:64252686-64252708 CCCCGGCCCCTGGGGCCCCCAGG - Intronic
1083670939 11:64299673-64299695 CCGGGGCCGCGGGGCCGCACGGG - Exonic
1084310377 11:68313008-68313030 CCCGGGACGCAGCGTCCCCGGGG - Intronic
1084958349 11:72703296-72703318 CCCGGGCAGCTGGGATCCCCTGG - Intronic
1085011059 11:73142104-73142126 CCCGGGCCGCCCGGGCCGCCCGG - Exonic
1085353490 11:75815592-75815614 CCCGGCTCGCGGGGTCAGCCCGG - Intronic
1088314924 11:108498100-108498122 CCCGGGCGGCGGGGACGCGCGGG + Intronic
1089590011 11:119534000-119534022 CCCGGCTCTCGGGCTCCCCCTGG + Intergenic
1090199911 11:124846484-124846506 CCCTGGCAGCTGGGTCACCCCGG - Intergenic
1091124503 11:133082788-133082810 CCCGGGCCGCGAGGAGGCCCAGG - Intronic
1091610620 12:2004521-2004543 CCCGGGCCGTGTGGTCGCCGTGG - Intronic
1095983861 12:47987121-47987143 CCTGGGCCACGGGGCCCTCCTGG - Exonic
1095985611 12:47997616-47997638 CCCGGCCCCCCTGGTCCCCCTGG - Exonic
1096083915 12:48852288-48852310 CCCAGGCTGCGGGGTCTGCCGGG + Intronic
1096680460 12:53252239-53252261 CCCGGTCTGCGGGGACGCCCCGG - Intronic
1097293731 12:57941725-57941747 CCCCTGCCGCGGGGCCCCGCCGG - Exonic
1098161232 12:67649308-67649330 CCCGGGGCGCGTCGTCCGCCCGG - Intronic
1100469044 12:94873800-94873822 CGCTGGCCGCGGGGTCCCCGGGG + Intergenic
1101482161 12:105108168-105108190 CCGGGGCCGCTGGGCCTCCCGGG - Intronic
1105407175 13:20142422-20142444 CCCGCGCCGTGGGCTACCCCGGG - Exonic
1105472093 13:20703792-20703814 CGCCGCCCGCGGGGTCCCCGGGG - Intronic
1105492640 13:20903057-20903079 CCCCGGCCTCGCGGTGCCCCCGG + Intergenic
1105557364 13:21459419-21459441 CGCGGGCCGCGGGCCGCCCCCGG + Intergenic
1106192486 13:27465941-27465963 CCCGGGCCTGAGGGTCCTCCCGG + Intergenic
1111950764 13:94707470-94707492 CCTGGGCCGCCGTGTCCTCCAGG - Intergenic
1111951472 13:94712210-94712232 CCCGGGGCGCGGCGTGGCCCTGG - Exonic
1113423995 13:110192838-110192860 CCCGGGCCACAGGGACCCCCGGG - Exonic
1113505410 13:110812905-110812927 CCCAGGCAGCGCGGTCCTCCTGG - Intergenic
1113542019 13:111115919-111115941 CGCGGGCGGCGGGGGTCCCCGGG + Intronic
1113660788 13:112105186-112105208 CCCTGCCCGCGGGGACCCCCGGG - Intergenic
1113790030 13:113023372-113023394 CCCGGGACGCTGGGCCCCCGAGG - Intronic
1113841705 13:113364483-113364505 CCGAGGCCGCGGCGTCCCGCGGG + Intergenic
1113948068 13:114056044-114056066 CCCAGGCCTCGGGGTTCACCTGG + Intronic
1114458446 14:22872178-22872200 CCCGGGCCATGGAGCCCCCCTGG + Exonic
1114525536 14:23365338-23365360 CCTAGGCCGCGGGGGCGCCCCGG + Exonic
1117067203 14:52022808-52022830 CCCTGGCCTCGAGTTCCCCCAGG + Intronic
1117253151 14:53954756-53954778 CCCGGGCCCCGGGGACGACCTGG - Intronic
1117378649 14:55138264-55138286 CCAGGGCCGCTGGGTGGCCCTGG - Exonic
1117647256 14:57865569-57865591 TCCTGGCGGCGGGGACCCCCCGG - Intronic
1117913117 14:60652968-60652990 CGCGGGGAGCGGCGTCCCCCAGG - Intronic
1120789156 14:88563249-88563271 GCCAGGCCGCGGCGTCCACCCGG - Intronic
1121253016 14:92513653-92513675 CCCGGGCCTCCGTGTGCCCCAGG + Intergenic
1122136594 14:99636333-99636355 CCTGGTCCACGGGGTCCCACTGG + Intergenic
1122523422 14:102363034-102363056 TCCGGGCCGCGGGGGCTGCCGGG - Exonic
1122637813 14:103138552-103138574 CCCGGGGAGGGGGGTCCACCTGG - Intergenic
1122736560 14:103847139-103847161 GCCCGGCCGCGGCGCCCCCCAGG - Intronic
1123073203 14:105652223-105652245 GCCGGGCAGCGTGGGCCCCCAGG + Intergenic
1202872523 14_GL000225v1_random:177584-177606 GCGGGGCCGCGGGGGCCGCCAGG - Intergenic
1124340255 15:28885814-28885836 CTCGGGACCCCGGGTCCCCCCGG - Intronic
1125720865 15:41844586-41844608 CCGGGGCCTCGGGCTCCACCTGG + Exonic
1126725012 15:51622850-51622872 CCCGGCTCGCGCGTTCCCCCCGG - Intergenic
1126837254 15:52679442-52679464 CCAGGGCCGCGGAGGCCGCCGGG - Intronic
1129016549 15:72474210-72474232 GCCGGGCCGTGGGGTCTCCCCGG + Intergenic
1131097482 15:89665746-89665768 CCCGGGCCGGGGGGCGCGCCGGG + Exonic
1131112957 15:89776815-89776837 GCGGGGACGCGGGGTCCCCTTGG + Exonic
1132497566 16:271020-271042 CCCGCCCCACGGGGTCCTCCAGG + Exonic
1132547528 16:540244-540266 CCCGGGTAGGGCGGTCCCCCGGG - Intronic
1132553643 16:563689-563711 CCAGGGCCAAGGGGTCCCCAGGG + Exonic
1132647777 16:1007043-1007065 CCGGGGCAGCGGGTTCCCCAAGG + Intergenic
1132683605 16:1153411-1153433 CCCGGGCGGCGCGGTCACCGCGG - Exonic
1132838885 16:1968616-1968638 CCTGGGCTGCGGGGCCACCCTGG + Exonic
1132884913 16:2178393-2178415 CCCGGGCCGGGGCGCCCACCGGG - Exonic
1133036557 16:3036864-3036886 CCCGGCCCTCGGCGTCCCCCAGG + Intronic
1133090665 16:3401406-3401428 GCTGGGCCGCGGGGCCGCCCTGG + Exonic
1133350501 16:5097840-5097862 GCGGGGCCCGGGGGTCCCCCGGG + Intergenic
1134080229 16:11319850-11319872 CCTGGGCAGTGGGGACCCCCAGG - Intronic
1135322571 16:21507174-21507196 CCCAGGCAGCCTGGTCCCCCAGG + Intergenic
1135572303 16:23558107-23558129 CCTGGGCTGCGGGGTCCCCAGGG - Exonic
1136141856 16:28293267-28293289 CCCCTGCCGCGGCGTCCCCGCGG + Exonic
1136334047 16:29600311-29600333 CCCAGGCAGCCTGGTCCCCCAGG + Intergenic
1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG + Intronic
1138448237 16:57077958-57077980 CCAGGGCTGTGGGATCCCCCAGG - Exonic
1138641700 16:58392831-58392853 CCAGGGCCGAGGGGCCCGCCGGG - Intronic
1140046323 16:71442325-71442347 CCCAGGCTGCGGCGTTCCCCAGG + Intergenic
1142034812 16:87856403-87856425 CCCAGGCAGCCTGGTCCCCCAGG + Intronic
1142130729 16:88430482-88430504 CCCGGGGCGCGGGGTCTGCGCGG - Exonic
1142206546 16:88785526-88785548 CCGGGGCCTCTGGCTCCCCCAGG + Intergenic
1142288870 16:89183583-89183605 CCAGGTCCGTGGGGTCCTCCAGG - Exonic
1142763912 17:2055629-2055651 AACGGGCCGCGGGGCCCCGCGGG + Intronic
1142966475 17:3585092-3585114 CCCTGGCCTGGGGGTCCCCAGGG - Intronic
1143485373 17:7251320-7251342 GCTGGGCCGCGGGGGCCCCGGGG - Exonic
1143510991 17:7394826-7394848 CCCGGGCCGCGCTGGCCCCTGGG + Exonic
1143749949 17:9021148-9021170 CCCCGCCCGCGCGCTCCCCCGGG + Intergenic
1143781716 17:9232729-9232751 CCCGGGACGGGGGGTCACCGTGG - Intronic
1144907746 17:18650287-18650309 CCCTGGCGGCGGGGTCGTCCTGG - Intronic
1145250978 17:21296966-21296988 GCCTGGCAGCGGGGTCCCCGGGG + Intronic
1146058769 17:29593756-29593778 GCCCGGCCGCGGGGTCCCCGCGG - Intronic
1146142324 17:30378911-30378933 TCCGGGCGGCGGGGGCCCGCCGG - Exonic
1147392886 17:40121511-40121533 GCGGGGCCGCGGGGCCCCTCCGG + Intergenic
1147393069 17:40122077-40122099 CCCGAGCCGCGGAGACCCCCGGG + Intergenic
1147686206 17:42288276-42288298 CCCCGACGGCGGGGTCCCCCGGG - Exonic
1147918092 17:43900519-43900541 CCCAGGCAGCGGGGTCTCCTTGG - Intronic
1148759695 17:49993361-49993383 CCAGGGCCGCGGGGGCGCGCGGG - Intronic
1148782447 17:50129618-50129640 CCCCGGCCGCGGGGGGCTCCGGG + Exonic
1149430669 17:56593933-56593955 CCCGCGCCCCGCGGTCGCCCTGG + Exonic
1149994396 17:61399337-61399359 TCCGGGGCGCAGGGACCCCCAGG + Intergenic
1150284324 17:63946742-63946764 CCCTGGCCGTGGGGCCCTCCTGG + Intronic
1152088390 17:78233813-78233835 CCCGAGCCCAGGGGACCCCCTGG - Intronic
1152108115 17:78342340-78342362 ACCGGGCGGCGGGGTCCCTCGGG - Intergenic
1152247206 17:79191273-79191295 CCTGGGGTGCGGGGTACCCCCGG - Intronic
1152357420 17:79813768-79813790 TGCGGGCCTCGGGGGCCCCCAGG - Intergenic
1152413920 17:80146761-80146783 CGCGGGCCGCGGGGGCCAGCCGG - Intronic
1152468499 17:80478192-80478214 TGCGGGCCGCGGGGTCCCTCTGG - Intergenic
1152733908 17:81987436-81987458 CCTGGGCCGGGCGGTGCCCCCGG + Intronic
1152793031 17:82292532-82292554 CCCGGCCCGCGGGTCCCTCCGGG + Intergenic
1153514480 18:5891335-5891357 CCCCCGCCGCGGCGCCCCCCGGG - Exonic
1153794455 18:8609645-8609667 CCCGGGCCCCGGCGCCCCCTCGG - Exonic
1154954679 18:21242402-21242424 CCCGCGCCCCGGAGTCCCCGCGG - Intronic
1155910338 18:31498155-31498177 CCCTGGCCCCGGCCTCCCCCCGG - Exonic
1160540367 18:79617429-79617451 CCCGGGGGGCGGGGTCCCGGGGG - Intergenic
1160580982 18:79884477-79884499 CCCCGGCCACTGGGTCCCCGGGG + Intronic
1160594652 18:79965006-79965028 CCAGGACCGCAGGGTCCCCCAGG - Intronic
1160631047 18:80246853-80246875 CCCGGGCCGTGGGATGGCCCTGG - Intronic
1160680267 19:408965-408987 CCCGGTCTGCGGGGACCGCCGGG - Intronic
1160772629 19:839863-839885 CCCGGGAGCTGGGGTCCCCCGGG + Intergenic
1160810058 19:1009391-1009413 CCCGGGCTGGGGGGCCCCCGTGG - Exonic
1160823503 19:1068752-1068774 CCCAGGCCTCGGTGTCCCCGTGG - Intronic
1160870774 19:1276805-1276827 CCCGGGCTGCTGGGGCCACCAGG + Intronic
1160971041 19:1767902-1767924 CCAGGGCCCCGGGGACCCCCAGG + Intronic
1161069012 19:2251261-2251283 CCAGCGCCGCGGGGTCCGACAGG - Exonic
1161252188 19:3286103-3286125 CCCGGGCCTCTGGGACCCGCGGG + Intronic
1161282661 19:3454166-3454188 GGCGGGCACCGGGGTCCCCCAGG - Intronic
1161314690 19:3612435-3612457 CCCGGGCCTCGGCCTCCCCCTGG + Intronic
1161959546 19:7516190-7516212 CGCCGGCCGCCGGCTCCCCCCGG - Exonic
1162127362 19:8506671-8506693 CCAGGGTCCCGGGGGCCCCCAGG - Intergenic
1162321599 19:9973935-9973957 CCAGGTCCTCGGGGTCCCCAAGG - Exonic
1162416997 19:10544166-10544188 CGCAGGCCGCGGGGTCCCAGAGG + Exonic
1162918870 19:13888842-13888864 CCCTGGCCGTGGGGTCCCAGGGG - Intronic
1162964582 19:14149871-14149893 CCCGGGCCGCAGGCTCCCGGTGG + Exonic
1163118072 19:15200167-15200189 CCAGGGCCTCCGGGTCCCCGCGG + Intronic
1163432044 19:17274051-17274073 CCCGGGCCCCAGGGGACCCCAGG - Intronic
1163607073 19:18281382-18281404 CCCGGGCCGCTTGTTCCCCGGGG - Exonic
1163701904 19:18790284-18790306 CTCTGACCGCGGGGTCTCCCCGG + Intronic
1163708610 19:18832351-18832373 CCCGGGCCGCCGGGGCCGCCGGG - Exonic
1163843931 19:19628223-19628245 CGCGGGAGGCGGGGTCTCCCCGG + Intronic
1164624221 19:29715569-29715591 CCAGGACCGCGGGGACCTCCCGG + Intronic
1165787976 19:38473681-38473703 CCCCGCCTGCGGGGTGCCCCCGG - Exonic
1166555907 19:43699781-43699803 CCCGGGCGGCGGGGTGGTCCAGG - Intergenic
1166682622 19:44778139-44778161 CCAGAGCCGCCGGGACCCCCGGG - Exonic
1166960711 19:46494424-46494446 CCCGGGCCCAGGGGTCCGACGGG + Exonic
1167287566 19:48607122-48607144 CACAGGCCACGGGGTCGCCCCGG + Exonic
1167503169 19:49858469-49858491 CCCAGCCCGCTGAGTCCCCCGGG - Intronic
1168076290 19:53982442-53982464 CCCGGGCCCCCGGGGCCGCCGGG - Exonic
1168344848 19:55645166-55645188 GCCGGGCTGCCGGGTGCCCCAGG + Exonic
1168527345 19:57099653-57099675 CCCAGGCGGTGGGGTGCCCCTGG + Intergenic
1168689760 19:58369257-58369279 CCCGGGCCCCGGAGGCACCCTGG + Exonic
925609538 2:5692094-5692116 CCCGGGCCGCCCGCTCCCCGTGG + Intergenic
927937621 2:27084447-27084469 CCTGGGCTGCAGGGACCCCCAGG + Exonic
929604753 2:43226809-43226831 CCCGGGCCGCCGGCCCCGCCCGG - Intergenic
930096471 2:47570372-47570394 CCCGGGCCACGACATCCCCCCGG + Exonic
931762615 2:65431344-65431366 CACGCGCCGCGGGGCCCCTCGGG + Intronic
932699587 2:73984280-73984302 GCAGGGCCGTGGGGTCCACCTGG + Intergenic
932771517 2:74503206-74503228 CCCGGACCCCGGGGTCACTCGGG - Intronic
932793341 2:74674494-74674516 TCCGGCCCCCGAGGTCCCCCTGG - Exonic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
935234295 2:101125194-101125216 CCCTGGCCCCGGGTGCCCCCTGG - Intronic
935250079 2:101253123-101253145 TCCTGCCCGCGGGGCCCCCCGGG - Exonic
937083807 2:119157989-119158011 CCAGGGCCGCGGGGGCCCCCTGG - Exonic
941008367 2:160270326-160270348 ACGTGGCCGCGGGGCCCCCCGGG - Intronic
941666543 2:168247908-168247930 CCCCGCCCTCGGGGTCCCCAGGG - Exonic
942116758 2:172735816-172735838 CCCAGGCCGCGGGAGCCCGCGGG + Intronic
943527805 2:189039517-189039539 CCTGGCCCTCCGGGTCCCCCTGG - Exonic
943571545 2:189580876-189580898 CTCGCGCCGCGGGGACGCCCGGG - Exonic
946321968 2:218959732-218959754 CCCCCACCGCCGGGTCCCCCGGG + Exonic
946622166 2:221572470-221572492 CACGGGGCGCGCGGTCTCCCGGG + Intronic
947142259 2:227030505-227030527 CCAGGGCCACCAGGTCCCCCTGG - Exonic
947669361 2:231926547-231926569 GCCGAGCCGCGGGATCCCTCCGG - Intergenic
947992172 2:234496706-234496728 CCCGGGGCTCGGCGTCCCCGCGG + Exonic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948468348 2:238162763-238162785 CCCGGTCCCCAGGGCCCCCCAGG + Exonic
949040130 2:241844174-241844196 GCCGGGCCTCGGGGCTCCCCGGG - Intergenic
1168830050 20:841029-841051 CCTGGCGCGCGGGGTCCCCGTGG - Intronic
1169345090 20:4823102-4823124 CCCGAGCCGCGGGGCTCCCGGGG - Intronic
1172586962 20:36092210-36092232 GCGGGGCCGCGGGGTTACCCCGG + Intronic
1173750305 20:45470622-45470644 CCCCGGACCCGGGGACCCCCGGG + Intronic
1173866855 20:46317802-46317824 CCAGTGCCCCAGGGTCCCCCCGG - Intergenic
1175579400 20:60087447-60087469 GCCGGGCCTCGGCGTCCCCGCGG - Intergenic
1175924951 20:62466993-62467015 CCCAGGCCGGGGGGCCCCACCGG + Intronic
1175950693 20:62581578-62581600 CCCGGCCTGCGGGCACCCCCCGG + Intergenic
1176131575 20:63498800-63498822 CCCGGCCCGCAGGGTCCCCGCGG + Intronic
1176156891 20:63626647-63626669 CCCCTGCGGCGTGGTCCCCCCGG + Intronic
1178951528 21:36989936-36989958 CCTGGGCCGCGAGGTCCCTATGG + Intronic
1179522535 21:41954192-41954214 CGCGGGCCGCGAGGTGACCCGGG + Intergenic
1179529594 21:42009795-42009817 CCCGGGCCGCGGGGTGTGCGCGG - Intronic
1179529814 21:42010692-42010714 CCCTTGCTGCGGGGTCGCCCCGG + Intergenic
1180071598 21:45439550-45439572 CCTGGGCCTCTGGCTCCCCCTGG + Intronic
1180085256 21:45505369-45505391 CCCGGCCCTCCGGGCCCCCCTGG + Exonic
1180091347 21:45535162-45535184 CCTGGGCCGGGGGGTCTCCCTGG + Intronic
1180181520 21:46120527-46120549 GCCAGGCCGCGGGGCCCCTCAGG - Exonic
1180285574 22:10741892-10741914 GCCAGGCCGCGGGGGCCGCCAGG + Intergenic
1180748994 22:18111407-18111429 CCAGCGCGGCGGGGTCCTCCGGG + Intronic
1180801389 22:18633782-18633804 CCCGGGCAGCCCGGTTCCCCGGG - Intergenic
1181220332 22:21361479-21361501 CCCGGGCAGCCCGGTTCCCCGGG + Intergenic
1181811233 22:25405020-25405042 CCCGGGACGCGGCGTCCCCGGGG + Intronic
1181956196 22:26589659-26589681 CCAGGCGCGCGGGGACCCCCAGG - Intronic
1182298998 22:29327608-29327630 CCCGGGCTGCAGGGACCCCAGGG - Intergenic
1182445583 22:30387490-30387512 ACTGGGCCGCGGGCGCCCCCTGG + Intronic
1183546038 22:38455305-38455327 CGCGGGCGGCGGGGCGCCCCGGG - Intergenic
1184146462 22:42614509-42614531 CCCGGAACGCGGGGGCCCCAGGG + Intronic
1184465772 22:44668446-44668468 TCCGGGCCGCCGGGTGACCCGGG + Intergenic
1184523562 22:45009122-45009144 CCCGGGGCGCGGGGGCCCGAGGG + Intronic
1184718828 22:46297206-46297228 CTCGGGCCCTGGGGTCCCCTGGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185138906 22:49089432-49089454 CCCAGGCCCCGGACTCCCCCAGG + Intergenic
1185151100 22:49164400-49164422 CCCGGGCCGCTGGGAGCCCTGGG + Intergenic
1185279047 22:49962185-49962207 ACCGCGCCGCGGGGGCCTCCAGG - Intronic
950211508 3:11126879-11126901 CCCGGGCAGAGGGGACACCCTGG + Intergenic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
953705440 3:45226516-45226538 CCCGGAGCGCGGGGGCGCCCGGG - Intergenic
953875149 3:46662427-46662449 CCCGGTCCCTGGGGTCGCCCTGG - Intergenic
953979823 3:47408000-47408022 CCCGGGCCTCTGGGGGCCCCAGG + Intronic
954136789 3:48585582-48585604 CCCGGCCCCCAGGGGCCCCCTGG - Exonic
961603413 3:128077086-128077108 CCCGGCCCGCGCTGACCCCCGGG - Intronic
961827220 3:129605493-129605515 CGCGGGCCGCGGGGGACCCCTGG + Exonic
961942976 3:130656601-130656623 CCCAGGCTTCGGGCTCCCCCTGG + Intronic
966696375 3:182793824-182793846 CCCGGGCCGAGAGGCCCCGCGGG - Intronic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
966712010 3:182980694-182980716 CCCGGGCGCGGGGGTCCCCCGGG + Intronic
967087300 3:186107672-186107694 CCCGCGCCCCGGGCGCCCCCAGG + Intronic
968433749 4:574926-574948 CCAGGGCCGCGGCGTCTCGCAGG + Intergenic
968491851 4:894241-894263 CCCGGGCCGCGGGGAGCGCAGGG + Intronic
968697924 4:2041853-2041875 CCCTGGCCGGGGGCTGCCCCCGG - Intronic
968741674 4:2334532-2334554 CCTGTGCCCCGGGGTCCCCTGGG + Intronic
969256879 4:6008274-6008296 CTGGGGCCGCGGTGTCCCACTGG + Intergenic
969306170 4:6327439-6327461 ACCTGGCCGCGGGTGCCCCCTGG + Intronic
969446481 4:7247704-7247726 CCAGGGTCGCCAGGTCCCCCAGG - Intronic
969568240 4:7992746-7992768 GGTGGGCCGCGGGGTCCCCGGGG + Intronic
971351849 4:25862722-25862744 CCCGAGTGGCGGCGTCCCCCAGG - Exonic
972396396 4:38663317-38663339 CCTGGGGCGACGGGTCCCCCTGG - Intergenic
972484247 4:39527247-39527269 CCCGGGCGGCGGGGCCAGCCTGG + Intronic
977231136 4:94452240-94452262 CCCGGGCTGCGGGGACCCCAGGG - Intronic
978576818 4:110197123-110197145 GTCGGGCCGCAGGGTCTCCCGGG - Intronic
980053828 4:128061646-128061668 CCCTGGCCTCGGGGCCACCCCGG + Intronic
980463462 4:133147569-133147591 CCCGCAACGCCGGGTCCCCCCGG - Intergenic
980686913 4:136240731-136240753 TCAGGGCAGCGGGGTCCCCCAGG - Intergenic
985513085 5:322820-322842 CCCAGGCGGCGGCGTCCGCCGGG - Intronic
985550201 5:528827-528849 CCGGGGCGGCGCGGTCCCTCCGG - Intergenic
985696794 5:1345277-1345299 CTAGGGCCGCGGGGTCCCCGGGG + Intergenic
985707910 5:1412270-1412292 CCCCTGCCACGGGGTCCCGCAGG + Intronic
986333703 5:6736989-6737011 CCTGGGCCGCGGGGCCCCTGAGG + Intronic
987099954 5:14582341-14582363 CCCGGGGCGCGTGGACCCGCGGG + Intronic
988577926 5:32444551-32444573 CCCGGGCAGCGGGGAGCCGCGGG - Intronic
989637949 5:43556640-43556662 CCCTGGCGGCGGGGTCGTCCTGG + Exonic
990308694 5:54518148-54518170 CCCGGGCCGCCGTCTCCCGCCGG - Exonic
993500499 5:88661003-88661025 CCCGGGCCGCAGCGCGCCCCCGG + Intergenic
995733006 5:115265468-115265490 CCCGGGCCTCCGGGCCTCCCAGG + Intergenic
1000318920 5:160118758-160118780 TCCGGTCCGCTGGGTCCCCAGGG - Intronic
1002044020 5:176532171-176532193 CCCTGGCCTCGAGGGCCCCCTGG - Exonic
1002299995 5:178252569-178252591 CCCGGACCACAGGGGCCCCCAGG - Exonic
1002661104 5:180791678-180791700 CCGGGGCCGCCGTGTCCACCTGG - Exonic
1003139145 6:3456731-3456753 CCCGGGGCGCGGGGTCCGGCGGG - Intronic
1003426586 6:6002147-6002169 CCCGGGCTGTGGGATCCCCTTGG + Intronic
1005856094 6:29864191-29864213 CCCGGGAGGCTGGGTCCCCGCGG + Intergenic
1005989140 6:30892418-30892440 CCCGGGCTCTGGGGTCCCCCAGG - Exonic
1006083522 6:31580984-31581006 CCCTGGCGGCGGGGACCCCCAGG - Exonic
1006089639 6:31620810-31620832 CCCGGGCCTAGGGGCTCCCCGGG - Exonic
1006296355 6:33171738-33171760 CCAGGCCCGCAGGGTCCCCCTGG - Exonic
1007633497 6:43285229-43285251 CCCGGGCCGGCGGGACGCCCCGG - Exonic
1009940190 6:70281415-70281437 CCCGGGCCTCCGGGCCCCCCTGG - Exonic
1010369464 6:75090208-75090230 CCAGGCCCGCCGGGTCCACCGGG - Exonic
1016438827 6:144063866-144063888 CCTGGGCCGTGGCGTCACCCCGG - Intronic
1017021273 6:150142622-150142644 ACCGCGCCGCAGGCTCCCCCAGG - Intergenic
1017110240 6:150925247-150925269 CCCCCGCCGCGTGGTCTCCCGGG + Intronic
1017805666 6:157943474-157943496 GCCAGGCTGTGGGGTCCCCCTGG - Exonic
1018903399 6:168062314-168062336 CCCGGGCTGTGGGGTGACCCTGG + Intronic
1019153465 6:170023860-170023882 CCCTGGAGGTGGGGTCCCCCGGG + Intergenic
1019305490 7:332587-332609 ACCGGGCGCCGGGGTCTCCCTGG + Intergenic
1019365845 7:632414-632436 CCCGAGCCGCAGGCTCCACCGGG + Intronic
1019379181 7:712356-712378 CCCGGGCCTGGGAGGCCCCCCGG - Intronic
1019476510 7:1247181-1247203 CCAGGGCTGCGGAGACCCCCGGG + Intergenic
1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG + Intergenic
1019927564 7:4203307-4203329 CCCAGGCCGCAGAGGCCCCCTGG + Intronic
1023177558 7:37448513-37448535 CCCGAGCCGCGGCGCCCCCAGGG + Intronic
1024394242 7:48847948-48847970 CCCGCGCCGCTGGGACCCCCAGG - Intergenic
1024401023 7:48924696-48924718 CCCGCGCCGCCGGGACCCCCAGG + Intergenic
1026841330 7:73671305-73671327 GCCGGGCCGAGGGGGCACCCGGG - Exonic
1027260589 7:76461964-76461986 CCGGGGCGGCGGGGACACCCGGG + Intronic
1027266322 7:76496995-76497017 CCCGGGGCACGGGGTCTCCTGGG - Intronic
1027311968 7:76960077-76960099 CCGGGGCGGCGGGGACACCCGGG + Intergenic
1027317702 7:76995113-76995135 CCCGGGGCACGGGGTCTCCTGGG - Intergenic
1029432337 7:100539376-100539398 CCCGGGCGGCGGGGTCAGCGGGG + Exonic
1029569989 7:101362997-101363019 CCCGGGACTCCGGGTCCCCGCGG + Exonic
1029597873 7:101547209-101547231 CCAGGACCCCGGGGTCCCCCTGG + Exonic
1029598303 7:101549176-101549198 CCTGGGCCTCGAGGTCCCCCAGG + Exonic
1030048950 7:105521731-105521753 CCCGCGCGGCGCTGTCCCCCGGG - Intronic
1031483181 7:122302018-122302040 CCCGGGCTGCAGGGGCCCCGGGG + Exonic
1033253248 7:139777954-139777976 CCCTGGCCGCGCGCTGCCCCCGG - Intronic
1033328369 7:140398160-140398182 GCCGGGCCGCAGGGTCCCCCGGG + Intronic
1033361321 7:140640677-140640699 CGCGCGCGGCGGGGACCCCCAGG - Exonic
1034264134 7:149773134-149773156 CCCGGGCGCCTGGGTCCCCGCGG - Exonic
1034421623 7:150993834-150993856 CCCAGGCCGCAGGGTGGCCCAGG - Exonic
1034475094 7:151277046-151277068 CCCGCGCCGCGCGGCCCCCACGG - Intronic
1034978014 7:155459069-155459091 GCCGGGACGCGTGGTCCCCGCGG - Intronic
1035637055 8:1155352-1155374 TCCGGGCTGGGGGGTCTCCCCGG + Intergenic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1037825189 8:22156504-22156526 CCCCGGCCCCGGGCCCCCCCTGG + Exonic
1049196874 8:141320601-141320623 ACAGGGCCTCGAGGTCCCCCAGG - Intergenic
1049460945 8:142727496-142727518 CCCGGGCCGCGTGCTGCCCTCGG + Exonic
1049504567 8:142989095-142989117 CCCGGGCTGCTGCGGCCCCCAGG + Intergenic
1050377201 9:4985377-4985399 CCCGGGCCGAGGGGCCCGACCGG - Exonic
1053201039 9:36151730-36151752 CCTGTGCCCCGGGGTCCCTCTGG + Intronic
1053482316 9:38424567-38424589 CCCGGGCCGCGGGCACCGCGCGG - Intergenic
1057054195 9:91949111-91949133 GCCGCGCCGGGGGGACCCCCGGG - Intronic
1057546032 9:96021125-96021147 CTTGGCCCGCGGGGTTCCCCGGG - Intergenic
1057619066 9:96619243-96619265 CCCGCGCCGCCGGGACCCCCAGG - Exonic
1057883071 9:98807853-98807875 CCCGGGGCGCGGGGTGCGCGGGG - Exonic
1057916102 9:99056350-99056372 CCTGGGCCACCGGGGCCCCCGGG + Exonic
1059123404 9:111661914-111661936 CCACGACCGCGGGGCCCCCCAGG - Intronic
1059438976 9:114292118-114292140 CCCGGACAGCTGGGTCCCCCTGG + Exonic
1060514632 9:124258112-124258134 TCCGGGCCGCGGGGCCCCACCGG - Intronic
1060897341 9:127225874-127225896 CCCGGGCCGCCGGCGCCCCTAGG + Intronic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061583972 9:131554747-131554769 CCTGGGCCGGGGCGTCCTCCGGG - Intergenic
1062111590 9:134785067-134785089 CCCGGTCCTCTGGGACCCCCTGG + Exonic
1062115530 9:134806249-134806271 CCTGGGCCCCAGGGACCCCCAGG + Exonic
1062202188 9:135309430-135309452 CCCGGGCAGAGCTGTCCCCCGGG - Intergenic
1062230656 9:135479943-135479965 CCCGGCCCGCCGCCTCCCCCGGG + Exonic
1062414832 9:136443028-136443050 CCCGGGCACCCGGGTCTCCCCGG - Intronic
1062426683 9:136509224-136509246 GCCGGGCCCCGGGTTCCCACTGG - Intronic
1062542042 9:137045837-137045859 CGCAGGCCGCGGGGCGCCCCGGG - Intronic
1062600155 9:137315888-137315910 CCTGGGCCTCGGGCTCCCTCCGG + Intronic
1062607562 9:137354953-137354975 CCGGGGCCGGCGGGACCCCCAGG - Intronic
1203731931 Un_GL000216v2:98958-98980 GCGGGGCCGCGGGGGCCGCCAGG + Intergenic
1185835882 X:3345866-3345888 CCCGGGCGGCGGGGACTCGCAGG - Intronic
1190775123 X:53546502-53546524 CCCGGGTCCCAGAGTCCCCCCGG + Exonic
1192952324 X:76029746-76029768 CCCGGGCCGCCTGGCCTCCCCGG - Intergenic
1195100477 X:101550683-101550705 CCCGCGCCGCAGGGATCCCCTGG - Intronic
1195782955 X:108484878-108484900 TCAGGGCAGCGGGTTCCCCCAGG + Intronic
1200000189 X:153056250-153056272 CCCCCGCCACGGGGGCCCCCGGG - Intergenic
1200120666 X:153788769-153788791 CCAGGGCCTGGGGCTCCCCCTGG + Intronic
1200163247 X:154019773-154019795 CGGGGGCTGCGGGCTCCCCCGGG + Exonic