ID: 1061149101

View in Genome Browser
Species Human (GRCh38)
Location 9:128818847-128818869
Sequence CCCGGGCCGCGGGGTCCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061149101_1061149112 3 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149112 9:128818873-128818895 GCTGGCCAAGTACGGGCTGCCGG 0: 1
1: 0
2: 0
3: 14
4: 170
1061149101_1061149110 -5 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149110 9:128818865-128818887 CCGGGCGAGCTGGCCAAGTACGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061149101_1061149113 4 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149113 9:128818874-128818896 CTGGCCAAGTACGGGCTGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1061149101_1061149114 5 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149114 9:128818875-128818897 TGGCCAAGTACGGGCTGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 75
1061149101_1061149111 -4 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149111 9:128818866-128818888 CGGGCGAGCTGGCCAAGTACGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1061149101_1061149116 9 Left 1061149101 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG 0: 1
1: 1
2: 3
3: 44
4: 344
Right 1061149116 9:128818879-128818901 CAAGTACGGGCTGCCGGGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061149101 Original CRISPR CCCGGGCCGCGGGGTCCCCC GGG (reversed) Exonic