ID: 1061152044

View in Genome Browser
Species Human (GRCh38)
Location 9:128834315-128834337
Sequence CCCTGGGTATAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061152033_1061152044 1 Left 1061152033 9:128834291-128834313 CCCAGAACATCATTCCAAGTCCC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG No data
1061152034_1061152044 0 Left 1061152034 9:128834292-128834314 CCAGAACATCATTCCAAGTCCCT 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061152044 Original CRISPR CCCTGGGTATAGAGGGCAGA GGG Intronic
No off target data available for this crispr