ID: 1061153172

View in Genome Browser
Species Human (GRCh38)
Location 9:128841047-128841069
Sequence CTGCATACTGTTCTGTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061153172_1061153176 4 Left 1061153172 9:128841047-128841069 CCAGGCAACAGAACAGTATGCAG 0: 1
1: 0
2: 0
3: 36
4: 231
Right 1061153176 9:128841074-128841096 TAAAAAGAACGAGTGCGGTCGGG No data
1061153172_1061153173 -1 Left 1061153172 9:128841047-128841069 CCAGGCAACAGAACAGTATGCAG 0: 1
1: 0
2: 0
3: 36
4: 231
Right 1061153173 9:128841069-128841091 GCCATTAAAAAGAACGAGTGCGG No data
1061153172_1061153175 3 Left 1061153172 9:128841047-128841069 CCAGGCAACAGAACAGTATGCAG 0: 1
1: 0
2: 0
3: 36
4: 231
Right 1061153175 9:128841073-128841095 TTAAAAAGAACGAGTGCGGTCGG No data
1061153172_1061153177 9 Left 1061153172 9:128841047-128841069 CCAGGCAACAGAACAGTATGCAG 0: 1
1: 0
2: 0
3: 36
4: 231
Right 1061153177 9:128841079-128841101 AGAACGAGTGCGGTCGGGTGCGG No data
1061153172_1061153178 12 Left 1061153172 9:128841047-128841069 CCAGGCAACAGAACAGTATGCAG 0: 1
1: 0
2: 0
3: 36
4: 231
Right 1061153178 9:128841082-128841104 ACGAGTGCGGTCGGGTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061153172 Original CRISPR CTGCATACTGTTCTGTTGCC TGG (reversed) Intronic
903305664 1:22411310-22411332 CTGTATACTATTTTGTTGCATGG + Intergenic
903644312 1:24884588-24884610 CTGAATACTGTTGTGTTGCATGG + Intergenic
903863331 1:26379051-26379073 CTGCATAGTATTCTGATGCATGG - Intergenic
909460288 1:75904534-75904556 CAGGATCTTGTTCTGTTGCCTGG + Intronic
910325987 1:86007601-86007623 CTGAATAATATTCTGTTGTCTGG - Intronic
911850603 1:102814414-102814436 CTGCTGACTGTTGTTTTGCCAGG + Intergenic
914017888 1:143838357-143838379 CTGCATACTCATTGGTTGCCAGG + Intergenic
914773638 1:150716040-150716062 CTGAATAATGTTCTATTGCATGG - Intronic
916242878 1:162657593-162657615 CTGAATTCTGTTCAGTTGTCTGG + Intronic
917131392 1:171745736-171745758 CTGCATACTATTCTATTGAATGG - Intergenic
918321479 1:183369300-183369322 CGGCATCTTGCTCTGTTGCCAGG + Intronic
918729564 1:187974290-187974312 CAGCATCTTGCTCTGTTGCCAGG + Intergenic
919244586 1:194964544-194964566 CTGAATACTTTTCTGTTGTATGG - Intergenic
920045247 1:203128442-203128464 CTGCATCCTGTTCTGTGCACAGG + Intronic
920262959 1:204702273-204702295 CTGTCTCCTGTTCTGTAGCCAGG + Intergenic
920296059 1:204957569-204957591 CTGTAAAGTGTTCTGTCGCCAGG + Intronic
923014751 1:230118188-230118210 CTGAATACTGTTCCGTTGTCTGG + Intronic
924928548 1:248706716-248706738 CTGCATTATGTTCAGTTACCTGG + Intergenic
1062998133 10:1887964-1887986 GTGCATACTGTTCAGGTGACGGG - Intergenic
1067471119 10:46538934-46538956 CTGAAAAATGTTCTGTTGTCTGG - Intergenic
1069914069 10:71776394-71776416 CTGCTTTCTGTTCTCTGGCCTGG + Intronic
1071094766 10:81960682-81960704 CTCCATACTGTCCTGCAGCCTGG + Intronic
1071104599 10:82079804-82079826 CTGAATAATATTCTGTTGCCTGG + Intronic
1073025094 10:100481991-100482013 GTGCATCCTGTCCTGTTTCCAGG - Exonic
1073195541 10:101687849-101687871 CTGGATGCTTCTCTGTTGCCTGG - Intronic
1075001769 10:118803913-118803935 CTGCAGACTATTCTGTTGTATGG - Intergenic
1075655663 10:124159459-124159481 CTTCTTCCTGTTCTGCTGCCAGG - Intergenic
1075887391 10:125913082-125913104 TTGCATACTTTTCTGTTTTCAGG - Intronic
1076125267 10:127969286-127969308 CTCCATACAGTGCTGTTGCTGGG + Intronic
1076585721 10:131546287-131546309 CTGCCAACTGTTCTCATGCCCGG + Intergenic
1076790327 10:132773786-132773808 CAGCCTCCTGCTCTGTTGCCCGG + Intronic
1079291428 11:19191529-19191551 CTGCATTCTATACTGTTTCCTGG - Intronic
1080875478 11:36270795-36270817 CTGCATTGTGTTGTGTTGTCAGG + Intergenic
1081565737 11:44259998-44260020 CTGAGTACCGTTCTGTTCCCAGG - Intergenic
1082019215 11:47517448-47517470 CTACATAGTGTTCTGTTGTATGG - Intronic
1082943453 11:58733124-58733146 CTGAATCCTGGTCTATTGCCTGG - Intergenic
1084367076 11:68708776-68708798 CTGAGTCCTGCTCTGTTGCCAGG + Intronic
1085676509 11:78524936-78524958 CTAAATAATATTCTGTTGCCTGG - Intronic
1087028943 11:93682663-93682685 CTGCATACTGTATTGTGGCCTGG + Intronic
1087310963 11:96543006-96543028 CTGGATACTGTTCTGTAACTTGG - Intergenic
1088467415 11:110156056-110156078 CTGCATACTGATGTGTTCCAGGG - Intronic
1089113007 11:116071970-116071992 CTGCATTCTGTGCTGTTTCACGG + Intergenic
1090463895 11:126915973-126915995 CTGGAGACTGTTCTGTGGCTGGG - Intronic
1091081864 11:132678534-132678556 CTGAATAGTATTCTGTTGTCTGG - Intronic
1092144036 12:6202370-6202392 CCGCATACTTTTCTGCTGCCAGG - Intronic
1094124170 12:27005520-27005542 CTGTATACTGTTCTGATGGAAGG - Intronic
1098184283 12:67879665-67879687 GTGGATACAGTTATGTTGCCTGG + Intergenic
1098955739 12:76687757-76687779 CTACACGCTGTTCTGATGCCTGG + Intergenic
1099387810 12:82038398-82038420 CAGCATTCTGTACTGTTCCCAGG - Intergenic
1102931759 12:116867713-116867735 CTGCATGATGTTCTGTTGCTTGG - Intronic
1103720298 12:122970807-122970829 CTGAATAATATTCTGTTGTCTGG - Intronic
1103729695 12:123019279-123019301 CTGAAGAATGTTCTGTTGCTTGG + Intronic
1103850312 12:123928640-123928662 CTGCATGCTGCTCTGGGGCCGGG + Exonic
1105387827 13:19948393-19948415 CTGAATAATATTGTGTTGCCTGG - Intergenic
1106364202 13:29061648-29061670 CTCCATCCTGTGCTGTGGCCAGG + Intronic
1106431141 13:29681701-29681723 CTGCATACTGTTCTCTGCCATGG + Intergenic
1107295088 13:38899547-38899569 CTGCACACTGATCAGTGGCCAGG - Intergenic
1114308625 14:21445662-21445684 CCGAATCCTGCTCTGTTGCCCGG - Intronic
1114721776 14:24890212-24890234 CTTCTTTCTGTTCTGTTGGCAGG - Intronic
1115394271 14:32890603-32890625 TTGCACACTGGTCTGTTCCCAGG + Intergenic
1119852896 14:77878681-77878703 CTTCATACTGTACTGTGTCCAGG + Intronic
1120332446 14:83111207-83111229 CTGAATAATATTCTATTGCCTGG - Intergenic
1120584289 14:86291818-86291840 CTCCATCCTGTTTTGGTGCCTGG - Intergenic
1121556072 14:94838560-94838582 CTGAATAATATTCTGTTGTCTGG + Intergenic
1124018864 15:25902127-25902149 CTGCAGCCTGTGCTGATGCCTGG + Intergenic
1127258476 15:57310504-57310526 CTACAAACTCTTCTCTTGCCCGG + Intergenic
1128672032 15:69580938-69580960 GTGCTTACTGTTTTGTTGCCTGG - Intergenic
1129946438 15:79542902-79542924 CTGCATATCGTTTTGTGGCCTGG + Intergenic
1132323467 15:100945030-100945052 CTGCATAGTGTTCTGTGACATGG + Intronic
1135995400 16:27244187-27244209 CTGCTGCCTGTTCTGCTGCCTGG + Intronic
1138681648 16:58687954-58687976 CTGAATAATGTTCTGTTGTATGG + Intergenic
1138819949 16:60246885-60246907 GTGCTTTCTGTTCTTTTGCCTGG - Intergenic
1139386407 16:66575094-66575116 ATGCCTACTGTTTTGGTGCCTGG - Intronic
1139757592 16:69157177-69157199 CTGCATATTGTTCAGCTGTCAGG + Exonic
1140345768 16:74211858-74211880 CTGCTTTCTGTTCAGTAGCCAGG - Intergenic
1143469720 17:7165038-7165060 CTCCATGTTGTTCTGTGGCCTGG + Intergenic
1146561399 17:33873247-33873269 CATCATACTGTTCTGTTACTGGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147859636 17:43510980-43511002 CTGAATACTGTTGTGTTGTATGG + Intronic
1149000470 17:51752347-51752369 CTCCATTCTGTTTTGTTTCCTGG - Intronic
1153652690 18:7255312-7255334 CAGAATCTTGTTCTGTTGCCAGG + Intergenic
1154362122 18:13672432-13672454 CAGAATCTTGTTCTGTTGCCAGG + Intronic
1155631518 18:27899534-27899556 CTGAATACTGTTTGATTGCCTGG + Intergenic
1155755000 18:29481908-29481930 CAGCATCTTGCTCTGTTGCCCGG + Intergenic
1155771991 18:29713063-29713085 CTGCCCATTGTTCTGTTGCTGGG + Intergenic
1156239524 18:35239563-35239585 TTGCTCACAGTTCTGTTGCCAGG - Intergenic
1159335535 18:67060463-67060485 CTGCATAGTGTTTTGGTGACTGG - Intergenic
1159651740 18:70986369-70986391 CTCCATCCTGTACTTTTGCCTGG - Intergenic
1160368912 18:78354934-78354956 CTGAATAATGTTCTGTTGCATGG - Intergenic
1161349235 19:3783269-3783291 CAGCATCCTGTTCCGTTCCCGGG + Intronic
1162035808 19:7938389-7938411 CTGAATAATATTCTGTTGTCTGG - Intronic
1162477469 19:10909119-10909141 CTGCATCATGTTCTGCTGCTGGG - Exonic
1164817110 19:31212892-31212914 CTGAATAATATTCTGTTGTCTGG - Intergenic
1165064707 19:33222086-33222108 CTTTATACTGTTCTGATGCTGGG - Intronic
1165165968 19:33856755-33856777 CTGAATAGTGTTCTGTTGTATGG - Intergenic
1166675080 19:44735704-44735726 CTGTATACTATTCTCTTGCATGG - Intergenic
1167086758 19:47315206-47315228 CTGTGTAGTATTCTGTTGCCTGG + Intronic
925014064 2:508487-508509 CTGCACACTGTTTTCTTGCTAGG + Intergenic
925258767 2:2511774-2511796 TTTCATACTGTTCTGGAGCCTGG - Intergenic
925793780 2:7521092-7521114 CTGCACGCAGCTCTGTTGCCTGG - Intergenic
925990955 2:9253758-9253780 CTGAATAATGTTCTGTTGTATGG + Intronic
926404803 2:12540316-12540338 CTGCACACTGTTCAATTCCCAGG + Intergenic
927053050 2:19348768-19348790 CTGCAAGCTGTTCTTTTCCCTGG + Intergenic
930611324 2:53547273-53547295 GTAGCTACTGTTCTGTTGCCTGG + Intronic
930655529 2:54003582-54003604 CTGAATAATGTTCAGTTGTCTGG + Intronic
931042031 2:58311596-58311618 TTGAATACTGTTCTGTTGTATGG - Intergenic
934935432 2:98461835-98461857 CTGCATGCTGGCCTGCTGCCAGG + Intronic
936046627 2:109193596-109193618 CTGCATAGTATTCTGTTGTATGG + Intronic
936474054 2:112824298-112824320 CTCCATCCTGTTCTCTTGCTTGG + Intergenic
943036422 2:182751456-182751478 TTGCACACTCTTCTGTTTCCTGG - Intronic
943378412 2:187111466-187111488 ACACATACTGTTCTTTTGCCAGG - Intergenic
944093126 2:195935845-195935867 CAGTGTACTGTTCTCTTGCCTGG - Intronic
945604449 2:211910993-211911015 CTGCAGGCTGTGATGTTGCCAGG - Intronic
946490550 2:220145185-220145207 CTGAACACTGTTCATTTGCCAGG - Intergenic
946570795 2:221021962-221021984 CTGCAGGCTGGTCTGTTTCCTGG - Intergenic
947406427 2:229782059-229782081 CAGCATATTTTTCTCTTGCCAGG - Intronic
947932338 2:233974256-233974278 CTGTATCTTGCTCTGTTGCCCGG + Intronic
948066998 2:235088165-235088187 CTACATTCACTTCTGTTGCCTGG + Intergenic
948260817 2:236603394-236603416 CTTCAGACTGTTCCTTTGCCTGG + Intergenic
1172419740 20:34805723-34805745 CTGCATACTAGTCTGGGGCCTGG - Intronic
1173512581 20:43641816-43641838 ATGGAGTCTGTTCTGTTGCCCGG + Intronic
1174823869 20:53751147-53751169 CTGCATGCTGTTATATTTCCTGG + Intergenic
1175204119 20:57298490-57298512 CTGAATAATATTCCGTTGCCTGG - Intergenic
1175825390 20:61933971-61933993 CTGCATCCTTTTCTGTCACCTGG - Intronic
1179115775 21:38490639-38490661 CTGCTGACTGTGCTGCTGCCAGG - Intronic
1180475107 22:15696749-15696771 CTAGATACTGTTGTGTTACCGGG + Intronic
1180707348 22:17817798-17817820 CTGCATCCTGCTCAGCTGCCTGG + Exonic
1180941852 22:19664765-19664787 CTGAATAATATTCTGTTGTCTGG - Intergenic
1181856357 22:25784107-25784129 CTTTATACTGTTTTGGTGCCTGG + Intronic
1181941276 22:26479355-26479377 CTCCACTCTGTTCTCTTGCCAGG - Exonic
1184837937 22:47035178-47035200 CTGCAGGCTGCTCTGCTGCCAGG + Intronic
1185026468 22:48416984-48417006 CTGCAGTCTGTGCTGTTGTCTGG + Intergenic
949581578 3:5393796-5393818 CTGCATTCCAGTCTGTTGCCAGG + Intergenic
950001983 3:9663812-9663834 CTGGAGTCTCTTCTGTTGCCAGG + Intronic
950536167 3:13580075-13580097 TTGCATAGTGTTCCGTTGCAGGG + Intronic
950688088 3:14633369-14633391 CTGGCTACTGCTCTGGTGCCAGG - Intergenic
953270392 3:41437117-41437139 CAGAATACTGTTCTGTTGAGTGG - Intronic
953527654 3:43707331-43707353 TTGAATACTTTTCTTTTGCCTGG + Intronic
954175012 3:48837740-48837762 CTAAATACTATTCTGTTGTCTGG - Intronic
956006545 3:64784702-64784724 CTGAATAATGTTCTGTTGTATGG + Intergenic
956035430 3:65085541-65085563 CTGAATAATATTCTGTTCCCTGG + Intergenic
957046037 3:75375383-75375405 CTATTTACTGTTCTGTGGCCTGG + Intergenic
959423527 3:106156809-106156831 CTACATCCTGTTCTGTTCCCTGG - Intergenic
961737741 3:129012738-129012760 CTGCATCCTTTTCTGTCTCCTGG - Intronic
962530055 3:136271018-136271040 CTGCATACTGGTCCTTTGTCAGG + Intronic
962911443 3:139855199-139855221 CTGTATACAGTTCTTTTGGCTGG + Intergenic
963916400 3:150862493-150862515 CTGCATCCATTTCTGTGGCCAGG - Intergenic
964511168 3:157453466-157453488 CTGCATGCATTTCTGATGCCAGG - Intronic
966439847 3:179932114-179932136 CTGCATAATGTTTTGTTTACTGG - Intronic
966503483 3:180672686-180672708 CTGCAGAATGTTCTGTTAACAGG - Intronic
968149282 3:196324418-196324440 GTGCTTACTGCTCTGTTGTCAGG - Exonic
968787981 4:2638224-2638246 CTGCCTACTCTTCTGTTCCCCGG + Intronic
968927601 4:3557947-3557969 CTGCCTGCTGTTCTCTTGCAAGG + Intergenic
969735522 4:8987172-8987194 CTATTTACTGTTCTGTGGCCTGG - Intergenic
973260924 4:48162236-48162258 CTGCATTCTGTTCAGAGGCCAGG - Intronic
973546918 4:51991425-51991447 CTCCATCCTGCTCTGTGGCCTGG + Intergenic
974358252 4:60840456-60840478 CTGAAAACTGTTCCTTTGCCTGG + Intergenic
976133334 4:81908267-81908289 CTGAATAATGTTCTGTTTTCTGG - Intronic
976659055 4:87520201-87520223 CTGCACACTGTACTCTAGCCTGG + Intronic
976867213 4:89743977-89743999 CTGCAGACCATTTTGTTGCCAGG + Intronic
977836619 4:101652698-101652720 CGGAATCCTGCTCTGTTGCCAGG - Intronic
980215348 4:129845561-129845583 CTGAATACTGTTTTGTTTTCTGG + Intergenic
983538310 4:168881497-168881519 CTGCATGCTGTTCTGTGAGCCGG + Intronic
986523838 5:8650858-8650880 CTAAATACATTTCTGTTGCCTGG + Intergenic
987708802 5:21484581-21484603 CAGCAGATTGTTCTGTTGCCGGG + Intergenic
988750808 5:34189564-34189586 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
990703054 5:58496595-58496617 CTGCAAACATTTCTTTTGCCAGG + Exonic
990989904 5:61674641-61674663 CAGCCTGCTGTTCTGTTTCCAGG + Intronic
991000306 5:61776162-61776184 ATGCATACTCTCCTCTTGCCGGG - Intergenic
991071531 5:62487936-62487958 ATGCATACTGTACTGTTTCCTGG + Intronic
991342637 5:65628281-65628303 CTCCATACTGTTTAATTGCCTGG + Intronic
991735946 5:69631488-69631510 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991739074 5:69652776-69652798 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991759124 5:69903655-69903677 CAGCAGATTGTTCTGTTGCCGGG + Intergenic
991788212 5:70214467-70214489 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991790649 5:70232517-70232539 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991812440 5:70487127-70487149 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991815400 5:70507604-70507626 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991818535 5:70528893-70528915 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991838353 5:70778721-70778743 CAGCAGATTGTTCTGTTGCCGGG + Intergenic
991880659 5:71214831-71214853 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
991883096 5:71232852-71232874 CAGCAGATTGTTCTGTTGCCGGG - Intergenic
993788187 5:92170957-92170979 CTCCATACTGTTCTCATGGCAGG - Intergenic
993842590 5:92898979-92899001 CTGCAGACTTTTCTGTTCCTGGG + Intergenic
993912985 5:93706838-93706860 CGGAATCTTGTTCTGTTGCCAGG - Intronic
994420933 5:99525932-99525954 CAGCAGACTCTTCTGTTGCCGGG + Intergenic
994486108 5:100388382-100388404 CAGCAGACTCTTCTGTTGCCGGG - Intergenic
995626007 5:114077207-114077229 CTGCTTACAACTCTGTTGCCTGG - Intergenic
995741735 5:115363156-115363178 TTGCAGAATGTTCTGTTGCATGG + Intergenic
996000000 5:118349175-118349197 CTAAATAATATTCTGTTGCCTGG + Intergenic
996228406 5:121030899-121030921 CTGTATTCTGTTCTGTTGATAGG - Intergenic
996352663 5:122562873-122562895 GTGCATGCTGTCCTGTTTCCGGG - Intergenic
997895036 5:137708838-137708860 CTGCATTCTTGTCTGTTTCCTGG - Intronic
998803017 5:145890112-145890134 CAGCATCTTCTTCTGTTGCCAGG + Intergenic
999051392 5:148527639-148527661 CAGAATCCTGTTCTGTTGCCCGG + Intronic
1000311009 5:160044693-160044715 CTGCATCCTGTTCTGTCAGCAGG + Intronic
1000437402 5:161230005-161230027 CTGAAACCTGTTCTGATGCCAGG + Intergenic
1000662552 5:163953402-163953424 CTGAATACTGCTTTGTTGCATGG + Intergenic
1000803572 5:165759702-165759724 CTGCATGCTATTCTGTTGTATGG + Intergenic
1001426248 5:171624534-171624556 CTGCAGAGCGTTCTGGTGCCTGG - Intergenic
1003740043 6:8926109-8926131 CTGCATTCTGTTCTGTTTTTAGG + Intergenic
1004299467 6:14444092-14444114 CTGCACAGTGTTCTGATGCTGGG - Intergenic
1005013497 6:21357385-21357407 CTGTACACTGTTCTGATGCAAGG - Intergenic
1005324491 6:24685829-24685851 CTGCATACTTTTTTGTTGTGGGG - Intronic
1005548880 6:26895869-26895891 CAGCAGATTCTTCTGTTGCCGGG - Intergenic
1006747847 6:36357436-36357458 CTTCATCCTGCTCTGTGGCCAGG - Intronic
1008440939 6:51531256-51531278 GTTTATATTGTTCTGTTGCCTGG - Intergenic
1009019629 6:57936979-57937001 CAGCAGATTCTTCTGTTGCCGGG - Intergenic
1009609438 6:65921708-65921730 CTCCATTCTGTTCTGGTGCAGGG + Intergenic
1011772253 6:90687170-90687192 CTGCATACTGATCTGTTAAAAGG + Intergenic
1014716407 6:124869408-124869430 CTGAATAATCTTCTGTTGTCTGG - Intergenic
1015080082 6:129213224-129213246 CTGAATACTATTTTGTTGTCTGG + Intronic
1018813279 6:167313149-167313171 CTCCATTCTGTTTTGTGGCCAGG + Intronic
1021947500 7:25742710-25742732 CTGCAGACTATACTGTGGCCAGG + Intergenic
1022064101 7:26833095-26833117 CTGCATACTTTTTTGGTGCTGGG - Intronic
1022440340 7:30427847-30427869 CTGCAAACTGTTCTGTAGTCTGG + Intronic
1027777371 7:82483639-82483661 AAGCATACAGTTCTGCTGCCTGG - Intergenic
1028130719 7:87169431-87169453 CAGGATCTTGTTCTGTTGCCAGG - Intronic
1028304521 7:89246647-89246669 CTGCATCATGATCTATTGCCAGG - Intronic
1028509666 7:91610303-91610325 CTGCTTCCTGTTTTGTTCCCTGG + Intergenic
1029576489 7:101406923-101406945 CAGCATCTTGTTCTGTTGCCCGG - Intronic
1030301213 7:107976604-107976626 CTGCAGGCTGTTGTGTTGCAGGG - Intronic
1036101629 8:5793319-5793341 CTGCTTATTGTTATGTTGCAAGG - Intergenic
1037077956 8:14745363-14745385 ATACATATTGATCTGTTGCCAGG + Intronic
1038503195 8:28062590-28062612 CAGCATCTTGCTCTGTTGCCTGG - Intronic
1041168972 8:55121063-55121085 CTGAATAATATTCTGTTGTCTGG + Intronic
1041250280 8:55927438-55927460 CTGAATAGTGTTCTGTTGTCTGG + Intronic
1042451003 8:68945624-68945646 CTGCAGACAGCTCTGTTCCCCGG - Intergenic
1043982286 8:86657000-86657022 CAGCAGCCTGTTCTCTTGCCTGG + Intronic
1044387250 8:91603492-91603514 CTGCATCTTGCTCTGTTGCCGGG - Intergenic
1044682487 8:94796174-94796196 CAGGATATTGCTCTGTTGCCCGG + Intergenic
1045989676 8:108291167-108291189 CTGAATACTATTCTGTTGTCTGG + Intronic
1047673697 8:127176155-127176177 CTGCATAATATTCCATTGCCAGG - Intergenic
1047975198 8:130123079-130123101 CTGCATAGTGTTCTGTTGTGTGG + Intronic
1049550884 8:143258920-143258942 CTCCAGACTGTGCTGCTGCCTGG - Intronic
1050324696 9:4488396-4488418 CTGCATAAGGTACTGTTGCTTGG + Intergenic
1051296785 9:15604824-15604846 TTGCATACTATTCTGTTACGTGG - Intronic
1052636608 9:31114663-31114685 CTGAATAATATTCTATTGCCTGG - Intergenic
1053802456 9:41773026-41773048 CTGCCTGCTGTTCTCTTGCAAGG + Intergenic
1054142782 9:61542044-61542066 CTGCCTGCTGTTCTCTTGCAAGG - Intergenic
1054190765 9:61984372-61984394 CTGCCTGCTGTTCTCTTGCAAGG + Intergenic
1054462530 9:65473194-65473216 CTGCCTGCTGTTCTCTTGCAAGG - Intergenic
1054647609 9:67603345-67603367 CTGCCTGCTGTTCTCTTGCAAGG - Intergenic
1055101566 9:72470866-72470888 CAGCATCTTGCTCTGTTGCCAGG - Intergenic
1056594112 9:87991472-87991494 CTGAATAATATTTTGTTGCCTGG + Intergenic
1057132739 9:92665976-92665998 CTGCAAATTGTTTTGTTGCCTGG - Intronic
1058170822 9:101679099-101679121 CTGCATAATGTCTTATTGCCAGG - Intronic
1059229678 9:112707350-112707372 CAGGATCTTGTTCTGTTGCCTGG + Intronic
1059914444 9:119083565-119083587 CTGCACGCTGTTGTGTTGGCTGG - Intergenic
1061153172 9:128841047-128841069 CTGCATACTGTTCTGTTGCCTGG - Intronic
1062470001 9:136698247-136698269 TTGCATAATGTTCTGTTTCCTGG - Intergenic
1186286573 X:8050146-8050168 ATGGATACTGTGCTGGTGCCAGG + Intergenic
1186824496 X:13325787-13325809 CTGCATATTCATCTGTTGCTCGG - Intergenic
1188504802 X:30870828-30870850 CTGGATAATTTTCTGTTGTCAGG - Intronic
1188589899 X:31820954-31820976 CGGCCTACTGTTATATTGCCAGG - Intronic
1189137926 X:38569041-38569063 CTTCAGACTGTTCTGTTTTCTGG + Intronic
1190011075 X:46785592-46785614 CTGAATAATATTCTGTTCCCTGG - Intergenic
1194087496 X:89546700-89546722 CTGCATACTGGTGTGATGCAGGG - Intergenic
1195642263 X:107189452-107189474 CTGCATACTGTTGTATTGTATGG - Intronic
1195877102 X:109552852-109552874 CTGCATGCTTTCCTGTTTCCTGG + Intergenic
1196089754 X:111726917-111726939 ATGCATACTGTGCTGCAGCCTGG - Exonic
1198054924 X:132984588-132984610 CTGCATGCTCTTCTGTCTCCTGG - Intergenic
1198120716 X:133589955-133589977 CTTCATACTGTTGCATTGCCGGG - Intronic
1198617603 X:138476792-138476814 CTGAATAATATTCTATTGCCTGG - Intergenic
1199110415 X:143927244-143927266 CTGAATAATATTCTGTTGTCTGG - Intergenic
1200086316 X:153608699-153608721 CTGAATAATGTTCCGTTGCCTGG - Intergenic
1200440141 Y:3202571-3202593 CTGCATACTGGTGTGATGCAGGG - Intergenic
1201673848 Y:16557258-16557280 CTGAATAATGTTCCGTTGCATGG + Intergenic