ID: 1061154084

View in Genome Browser
Species Human (GRCh38)
Location 9:128846675-128846697
Sequence CAGGGTCACCCAGCCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061154084_1061154096 26 Left 1061154084 9:128846675-128846697 CCCACCTTGGCTGGGTGACCCTG 0: 1
1: 0
2: 5
3: 32
4: 239
Right 1061154096 9:128846724-128846746 TCAGAATCCCTTCAGCAGCAGGG 0: 1
1: 0
2: 0
3: 29
4: 173
1061154084_1061154095 25 Left 1061154084 9:128846675-128846697 CCCACCTTGGCTGGGTGACCCTG 0: 1
1: 0
2: 5
3: 32
4: 239
Right 1061154095 9:128846723-128846745 CTCAGAATCCCTTCAGCAGCAGG 0: 1
1: 1
2: 5
3: 22
4: 241
1061154084_1061154089 -9 Left 1061154084 9:128846675-128846697 CCCACCTTGGCTGGGTGACCCTG 0: 1
1: 0
2: 5
3: 32
4: 239
Right 1061154089 9:128846689-128846711 GTGACCCTGGATAGGTAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061154084 Original CRISPR CAGGGTCACCCAGCCAAGGT GGG (reversed) Intronic
900185036 1:1328926-1328948 CAGGGGCACCCAGTGAGGGTGGG + Intergenic
901530898 1:9851901-9851923 CAGGGTCAGGGAGTCAAGGTGGG - Intronic
902184518 1:14715176-14715198 CAGGGCGTCTCAGCCAAGGTGGG - Intronic
902244024 1:15107489-15107511 CAGGGTCACACAGCCAGGATTGG - Intronic
903179934 1:21600072-21600094 CAGGGTCACTCAGCACAGGTGGG + Intronic
903562481 1:24238284-24238306 AAGGCTCACCCAGCCATGCTGGG - Intergenic
903806922 1:26012250-26012272 TAGGGTCACCCAACCAGTGTGGG - Intergenic
904662075 1:32092846-32092868 CAAGGTCACCCAGCCAATGAGGG + Intronic
905883360 1:41478628-41478650 CAGAGACACCCAGCAAGGGTGGG + Intergenic
906111324 1:43323916-43323938 CAACTTCAGCCAGCCAAGGTAGG + Intergenic
906203342 1:43973892-43973914 CAAGGTAACCCAGACAAAGTGGG + Intergenic
906643060 1:47453004-47453026 CAGGGATACCCAGCCATAGTAGG - Intergenic
907247905 1:53119922-53119944 CAGGAGCACCCAGCCAAGCGTGG - Intronic
907329811 1:53663555-53663577 CAGGGTCACGGAGCCCAGCTTGG - Intronic
912302650 1:108533952-108533974 CCGCTTCAGCCAGCCAAGGTTGG + Intergenic
912569909 1:110613765-110613787 CAGGGTCACCCAGCCAGTCCAGG + Intronic
913538435 1:119796190-119796212 CAGGGTCACACAGCTCAGCTAGG + Intronic
914513915 1:148357510-148357532 CAGGGTCACTTAGCCAGGGAAGG - Intergenic
915691132 1:157692073-157692095 CAGGGCCACCCAGGCACGGAGGG + Intronic
917675008 1:177310524-177310546 CAGAGTCACCCAGCTATAGTTGG - Intergenic
918013087 1:180605600-180605622 CAGTGTCTCCCAGGCAAGATGGG + Intergenic
920306241 1:205019970-205019992 CACCATCACCCAGGCAAGGTGGG - Exonic
920342859 1:205286534-205286556 CAAGGTCACACAGCCAATCTGGG + Intergenic
921563769 1:216691104-216691126 CAGTGTAAGCCAGTCAAGGTAGG + Intronic
923497095 1:234535113-234535135 CAGGGTCACCCAGCAACCCTGGG - Intergenic
1063028967 10:2212276-2212298 CAGGCTCACCTTGTCAAGGTTGG - Intergenic
1063515877 10:6694759-6694781 AAGGTGCTCCCAGCCAAGGTAGG - Intergenic
1064264599 10:13815166-13815188 CTGGGTCTCACAGCCAAGCTGGG + Intronic
1064859818 10:19815741-19815763 CAGGGAGACCCCGCCAGGGTCGG + Intergenic
1069621213 10:69838286-69838308 TAGGGTCACCCAGCCAATGCTGG + Intronic
1069866425 10:71506503-71506525 CAGGGTCCCCCAGCCAGAGATGG + Intronic
1070179482 10:73999466-73999488 CTGAGTCACCCACCCAGGGTGGG - Intronic
1070540060 10:77409382-77409404 CAGGGCCACCCAGCCCAGCCAGG + Intronic
1070798295 10:79230004-79230026 CAGGGTCACACAGCTAGGGAGGG + Intronic
1072922781 10:99590624-99590646 CATGGTCATCCAGCTAAGGTGGG - Intergenic
1074696433 10:116053819-116053841 CAAAGTCACACAGCCAGGGTGGG - Intergenic
1076266888 10:129115635-129115657 CAAGGTCACACAGCCAAAGATGG + Intergenic
1077514078 11:2991507-2991529 CTTGGTTTCCCAGCCAAGGTGGG - Intronic
1079937483 11:26635602-26635624 CAGGCTCACACAGTCTAGGTAGG - Intronic
1080270224 11:30443385-30443407 CAAGGTCACCCAGCACAGATGGG + Intronic
1080408780 11:32003731-32003753 CAGGGTCACACAGCCAATCAAGG + Intronic
1080685926 11:34514730-34514752 CCAGGTTACCCAGCCAAGATAGG - Intergenic
1082085849 11:48048948-48048970 CAGGCTCACACAGCCAATGCTGG + Intronic
1082849323 11:57751924-57751946 CAAGTACACCCAGCCAAGGGTGG - Intronic
1083661835 11:64255021-64255043 CAGGATGACACAGCCAAGGTGGG + Exonic
1084242126 11:67828953-67828975 CATGGTCACCCAGCTGAGGAAGG + Intergenic
1084566056 11:69929830-69929852 CAAGGTCACCCAGCCAGGAAGGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1084689190 11:70715271-70715293 CAGGGTCACCCAGCCGGGAAGGG + Intronic
1085715252 11:78866840-78866862 TAGGGTCACCCAACCAAGGTTGG + Intronic
1085786599 11:79457079-79457101 CAAGGTCACACAGCTAAGTTGGG - Intergenic
1086414040 11:86570916-86570938 CAGGATCACACAGCCAGGGGAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089202579 11:116733262-116733284 CAGGGACTCCCAACCCAGGTGGG - Intergenic
1089342363 11:117766979-117767001 CAAGGTCACACAGCCAGGGAGGG - Intronic
1089351819 11:117825606-117825628 CAGGGTCACACAGCCAGTGTGGG + Intronic
1089774978 11:120829772-120829794 CAAGGTCACTTAGCCAAGGAGGG + Intronic
1090719692 11:129460082-129460104 CAGGGGCACCCACCCATGCTGGG - Intergenic
1091712072 12:2749278-2749300 CACGGACAGCCAGCCAAAGTAGG + Intergenic
1092355247 12:7789251-7789273 CAGAGTAACCCAGACTAGGTGGG - Intronic
1092367898 12:7892217-7892239 CAGAGTAACCCAGACTAGGTGGG - Intergenic
1101420454 12:104546435-104546457 CAGGGTCTGTCACCCAAGGTGGG - Intronic
1101748005 12:107558854-107558876 CAAGGTCACACAGCTAAGTTAGG + Intronic
1102458200 12:113084090-113084112 TAGGGTCACCCAGCCAGTGGGGG + Intronic
1102929442 12:116851149-116851171 CAGGGTCACCCAGCCAGCATGGG + Exonic
1103487727 12:121294629-121294651 CAGGGTCACACAGCCAGTGCAGG - Intronic
1104714592 12:131008013-131008035 CAGGGTCACACAGATAAGGAGGG - Intronic
1104902621 12:132197577-132197599 CAGGGTCACACAGCCAGAGAGGG - Intronic
1104934078 12:132355268-132355290 CGGTGTCTCCAAGCCAAGGTGGG + Intergenic
1105044870 12:132994135-132994157 CAGGGGGACCCAGTCATGGTGGG - Intronic
1108520742 13:51244859-51244881 CAGGCTCTCCCACCTAAGGTGGG + Intronic
1108804634 13:54139113-54139135 TAGGGTCATCCTGTCAAGGTGGG - Intergenic
1111396760 13:87675831-87675853 CAGGTTCTCCAAGCCAAGGAAGG - Exonic
1112749180 13:102564836-102564858 CAAGGACACCCAACTAAGGTGGG + Intergenic
1114411918 14:22508994-22509016 AAGGGTCACACAGCCAAAGACGG + Intergenic
1115643067 14:35347630-35347652 CAGGGTCGCCCAGGCTGGGTTGG + Intergenic
1117092595 14:52266191-52266213 CAGGGTCACACAGCCAGTGGTGG + Intergenic
1117420692 14:55542276-55542298 CAGGGAGACCCAGTCAAGGTGGG + Intergenic
1118371907 14:65144489-65144511 CTGGGGCACCCAGCAGAGGTGGG + Intergenic
1121609816 14:95270067-95270089 CAGGGTCAGACAGCCAGGGAGGG + Intronic
1122116415 14:99529731-99529753 CTGGCTTACTCAGCCAAGGTAGG - Intronic
1122164860 14:99814972-99814994 CAGGGTCACACAGCTAGGGAGGG + Intronic
1123068710 14:105630650-105630672 CAGGCTCCCCCAGCACAGGTAGG - Intergenic
1123072705 14:105649453-105649475 CAGGCTCCCCCAGCACAGGTAGG - Intergenic
1123092734 14:105748978-105749000 CAGGCTCCCCCAGCACAGGTAGG - Intergenic
1123098296 14:105776678-105776700 CAGGCTCCCCCAGCACAGGTAGG - Intergenic
1128555401 15:68628307-68628329 CAAGGTCACCCAGGCAAGAAGGG - Intronic
1129038411 15:72664852-72664874 CAGGGTTACACAGTCAGGGTGGG + Intronic
1129059311 15:72848216-72848238 CAGGGTCACCCAGCAAGAGCTGG + Intergenic
1129211479 15:74072379-74072401 CAGGGTTACACAGTCAGGGTGGG - Intronic
1129219029 15:74120689-74120711 CAAGGTCACACAGCAAAGCTGGG - Intronic
1129398925 15:75268705-75268727 CAGGGTTACACAGTCAGGGTGGG + Intronic
1129402533 15:75292981-75293003 CAGGGTTACACAGTCAGGGTGGG + Intronic
1129657022 15:77531153-77531175 CAAGGTCACACAGCGAAGATAGG - Intergenic
1129779331 15:78259866-78259888 CAGGGTCACACAGCCAGTGAGGG + Intergenic
1130997424 15:88911770-88911792 CAGAGTCACCCATCTAAGGCTGG + Intronic
1132351615 15:101142870-101142892 CCAGATCACTCAGCCAAGGTGGG + Intergenic
1133229768 16:4360938-4360960 CAGGGCCACCAAGACCAGGTAGG - Exonic
1133353638 16:5119888-5119910 CACGGTCACCCAGCTGAGGAAGG + Intergenic
1134135273 16:11673168-11673190 CAGGCTCACCCAGCCATGGTGGG + Intronic
1134238889 16:12489488-12489510 CAGGGTCACACAGCCAGTGTGGG - Intronic
1134677314 16:16099706-16099728 CAGATTCCCCCAGCCAAGGTGGG - Intronic
1136033267 16:27518987-27519009 CAGGGCCAGCCAGCCATGCTGGG + Intronic
1137574598 16:49590577-49590599 CAGGGTGACTTAGCCAAGGCTGG + Intronic
1137693483 16:50446000-50446022 CATGGTCACCCAGCAAAGATGGG - Intergenic
1137931579 16:52592963-52592985 CAGGGTCAACCAGCTAATATCGG - Intergenic
1138537745 16:57668690-57668712 CAGGGAGACACAGCCCAGGTTGG - Intronic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1141433362 16:83982474-83982496 CCGAGTCACCCAGACAAGGGTGG + Intronic
1141492890 16:84386812-84386834 GAGGGTCACACAGCGTAGGTGGG + Intronic
1141546747 16:84775579-84775601 CCTGGTCACCCAGCCAGGTTGGG + Intronic
1141946293 16:87312110-87312132 CAGGGTCACAGTGCCAAGGGTGG - Intronic
1143317108 17:6041081-6041103 CAGGAAGACCCTGCCAAGGTGGG - Intronic
1144610607 17:16710234-16710256 AAGGGTGAACCAGCCCAGGTCGG + Intronic
1144740410 17:17579116-17579138 CAGGGTCAGCCAGCCCTGGGGGG + Intronic
1144902136 17:18605159-18605181 AAGGGTGAACCAGCCCAGGTCGG - Intergenic
1144928928 17:18840793-18840815 AAGGGTGAACCAGCCCAGGTCGG + Intronic
1144958646 17:19032685-19032707 CAAGGTCACCCAGCAAAGTGGGG - Intronic
1144976513 17:19141839-19141861 CAAGGTCACCCAGCAAAGTGGGG + Intronic
1145130363 17:20340918-20340940 AAGGGTGAACCAGCCCAGGTCGG + Intergenic
1146645082 17:34571917-34571939 CCTGGGCACCCAGCCAAGGGAGG - Intergenic
1146664551 17:34688974-34688996 CAGGGAGAGCCAGCCAAGCTAGG + Intergenic
1147238557 17:39075510-39075532 CAAGGTCACACAGCCAAGAAGGG - Intronic
1147849174 17:43427923-43427945 CAAGTTCCCCCAGCTAAGGTGGG - Intergenic
1147894034 17:43738656-43738678 CAGGCTCAGCCTGACAAGGTAGG + Intergenic
1149605686 17:57923558-57923580 CTGGGACATCCAGCCAAGGCAGG - Intronic
1155239930 18:23855318-23855340 AAGGTTCACCCAGCCTACGTCGG + Intronic
1156555382 18:38062208-38062230 CAGGGTCACTAAGCAAAGGAAGG - Intergenic
1158272417 18:55731097-55731119 CAAGGTCACACAGCCAAGTACGG + Intergenic
1158300563 18:56047412-56047434 CAAGTTCACCTAGGCAAGGTAGG + Intergenic
1159919705 18:74216405-74216427 CAGGGCCATCCGGTCAAGGTGGG + Intergenic
1160798269 19:955514-955536 CATGTACAGCCAGCCAAGGTTGG - Intronic
1160823671 19:1069532-1069554 CTGGCTCACCCAGCCAGGGCAGG + Intronic
1160873995 19:1288850-1288872 CAGGGGTACCCAGCCCAGGTTGG - Intronic
1162450166 19:10749602-10749624 CAGGGCCACACAGCCCAGGAGGG + Intronic
1162922613 19:13912502-13912524 CAGGGACACACAGCCAGGGCAGG - Intronic
1163443636 19:17334207-17334229 CAAGGTCACACAGTCAAGCTGGG + Intronic
1163551734 19:17969301-17969323 CAAGGTCACCCAGCCAGGAAAGG - Intronic
1165151617 19:33763964-33763986 CATGGCCACCCAGCCAGGGCTGG + Intronic
1165823767 19:38693838-38693860 CATGGTGACCCAGCTAAGGCGGG - Intronic
1165933125 19:39373079-39373101 CAGTGACACCCAGCCCAGGAAGG - Intronic
1166345537 19:42163048-42163070 CAAGGTCACACAGCCAAGTGGGG + Intronic
1166668903 19:44698190-44698212 CAGGAGGACCCAGGCAAGGTGGG + Intergenic
1166748198 19:45151944-45151966 CAGGGCAATCCAGCCCAGGTGGG - Exonic
1167133536 19:47603098-47603120 CAGGGTCACTCAGGCAGGGTGGG + Intergenic
1168100007 19:54136359-54136381 CAGGGTCACACAACCGAGATGGG - Intergenic
1168700746 19:58437985-58438007 CTGAGTCCCCAAGCCAAGGTGGG - Intronic
925370869 2:3344489-3344511 CAGGGTCACACAGCCAGGAATGG - Intronic
925696355 2:6584120-6584142 AAGGATCACACAGCCAAGGAAGG + Intergenic
925977323 2:9150426-9150448 CAGGGTCACACAGCCAGGTGGGG + Intergenic
933704923 2:85282631-85282653 CAGGGTCACACAGCCTATGTTGG + Intronic
933849804 2:86356809-86356831 CAGGGTCACCCAGCCAGCAATGG + Intergenic
934560324 2:95309938-95309960 CAGGGTCACACAGCCACGTCTGG - Intronic
936110720 2:109662256-109662278 CAGGGTGAACCAGAGAAGGTGGG - Intergenic
938320563 2:130359594-130359616 CAGGATCACCTAGACAAGGAGGG - Exonic
938457262 2:131474746-131474768 CAGGCTAGGCCAGCCAAGGTGGG + Intronic
945269695 2:207925674-207925696 CTGGGTTACCAAGCCCAGGTGGG - Intronic
946181820 2:217953574-217953596 CAGGGTCCCCCAGCCAGGGCAGG - Intronic
946434792 2:219644343-219644365 CTGTGTCACACAGCCAAGCTGGG - Intergenic
947271816 2:228344685-228344707 GAGGGTCACTCAGATAAGGTAGG + Intergenic
948229254 2:236337553-236337575 CAGGGTCACCCAGCTATGCAGGG + Intronic
1169299807 20:4432159-4432181 CATTGTCACCCAGGAAAGGTTGG + Intergenic
1170551545 20:17481432-17481454 CAGGCTCACACAGCCAGTGTGGG + Intronic
1170588860 20:17755953-17755975 CAGGGTCTCCCCACCATGGTTGG - Intergenic
1172867248 20:38109722-38109744 AAGGGTCAGCCAGCCTCGGTGGG - Intronic
1173671271 20:44800680-44800702 CAGAGTCTCCCAGAGAAGGTAGG - Intronic
1173922233 20:46754955-46754977 CAAAGTCACCCAGCCAGTGTGGG - Intergenic
1173965606 20:47110183-47110205 CAAGGTCACCCAGCTTAGGAGGG + Intronic
1174034433 20:47659549-47659571 CAGGATCACCCACCAAAGATAGG - Intronic
1174295881 20:49544751-49544773 CAAGGTCACACAGCCAAAGCGGG + Intronic
1175291733 20:57880542-57880564 CAGGGTCACCCAAGCAGGGATGG - Intergenic
1175488265 20:59361129-59361151 CTAGGTCACACAGCCATGGTGGG + Intergenic
1175607279 20:60321358-60321380 CAGGGTCACATTGCCAAGGATGG - Intergenic
1178499012 21:33110460-33110482 CAGGGTCACACAGCAAGGGCTGG - Intergenic
1180883596 22:19224119-19224141 CAGGGTCATCGAGGGAAGGTGGG - Intronic
1181562101 22:23711221-23711243 CCAGGTAACCCAGCCAAAGTTGG + Intergenic
1181728581 22:24828256-24828278 CAGGGTCACACAGCCAGGAAAGG - Intronic
1181745050 22:24950428-24950450 CAGGGGGAACCAGCTAAGGTGGG + Intergenic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1181911563 22:26242354-26242376 CAAGATCACCCAGCCAGGGAGGG - Intronic
1182097522 22:27636108-27636130 CTGGGTCCCCCAGCCATGCTGGG + Intergenic
1183530132 22:38348858-38348880 CAGGGTCAGCCTGCCAGGCTGGG + Intronic
1183655821 22:39184191-39184213 CAGTGTCTCCCAGCCCAGGGTGG - Intergenic
1183655998 22:39185002-39185024 CAAGTTCACCCAGCCAGAGTGGG - Intergenic
1183738691 22:39658059-39658081 CAGGGTCACACAGCCAGGGTGGG + Intronic
1184716755 22:46286985-46287007 CAGGGTCAGCCTGTCCAGGTGGG - Intronic
1184968619 22:47999158-47999180 CAGGGTGATTCAGCCAAGCTTGG - Intergenic
1185015542 22:48340529-48340551 CAGGGCCACACAGCCATGGAGGG + Intergenic
1185235569 22:49710820-49710842 CAGGGGCACCCAGGGAGGGTGGG - Intergenic
949473552 3:4420913-4420935 CAGGGTCACCCAGCTAATGTTGG - Intronic
949981858 3:9507046-9507068 CAAGGTCATACAGCCAAGTTAGG - Intronic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
950907647 3:16553613-16553635 CAGGGAAACCTAGCCAAGTTTGG + Intergenic
951685098 3:25335070-25335092 CAGGGTCAGCCAGCCAGCATGGG - Intronic
952960850 3:38588388-38588410 CAGGTTCTGCCAGCCAAGGCTGG - Intronic
954405454 3:50342777-50342799 CAGGATGCCTCAGCCAAGGTTGG - Intronic
954626022 3:52022293-52022315 CAGGGTCACACAGCCATAGTGGG - Intergenic
954919428 3:54176954-54176976 CTGGGTCACCCAGCCAGGATGGG - Intronic
956560043 3:70565200-70565222 CAGGGTCCCACAGTCAGGGTGGG + Intergenic
959804016 3:110529337-110529359 CAGAGGCACCCAGCTAAGCTGGG + Intergenic
961640152 3:128360097-128360119 CAGAGGCACCCAGCCATGGGAGG + Intronic
961652346 3:128422799-128422821 CAGGGACAGCCAGCCCAGGCTGG + Intergenic
961928181 3:130505362-130505384 CAAGGTCACCCAGCCAATGGTGG - Intergenic
967988457 3:195113703-195113725 CAGGCTCCCTCAGCCAAGCTCGG - Intronic
968426207 4:525065-525087 CGGGGTCAGCCAGGCAAGGCAGG + Intronic
968529795 4:1085577-1085599 CAGAGTGACCCAGCACAGGTGGG - Intronic
968967216 4:3775209-3775231 CTGGGGCTCCCTGCCAAGGTGGG + Intergenic
969055212 4:4397404-4397426 CAAGGTCACCCAGCTAATGAGGG + Intronic
969276050 4:6136569-6136591 CACGGTCACACAACCAAGGATGG + Intronic
969813502 4:9668560-9668582 CACGGTCGCCCAGCTAAGGAAGG - Intergenic
969866852 4:10082015-10082037 CAAGGTCACCAGGCCAAGGCTGG + Intronic
970858630 4:20676708-20676730 CAGCATCACCCAGACCAGGTTGG + Intergenic
972378074 4:38492026-38492048 CAAGGTCACACAGCTAATGTTGG + Intergenic
976965681 4:91037317-91037339 CAGGGTCACAGATCCCAGGTGGG - Intronic
984684003 4:182645542-182645564 CAGAGGCACCCAGCTAAGTTGGG - Intronic
985567805 5:629190-629212 GAGGGTCACCATGCTAAGGTGGG + Intronic
988350892 5:30106202-30106224 CAGGCTCAGCCAGCAAAGGCAGG + Intergenic
989589031 5:43096295-43096317 CAGGGTGATCCAGCCAAGTGAGG + Intronic
990350340 5:54909458-54909480 CAGGGTCACACAGCCAAGCTGGG + Intergenic
993786677 5:92147499-92147521 CAAGGGCACCCAGCCTAGATTGG + Intergenic
994124397 5:96153266-96153288 CAGAGTGAACCAGCCAAGGTGGG - Intergenic
999256233 5:150211329-150211351 CAAGGTTACCCAGCCAAGCCGGG + Intronic
999309029 5:150539504-150539526 CAAGGTCACACAGCCGAGGCAGG - Intronic
1000978355 5:167789485-167789507 CTGGATCGCCCAGCCAAGTTTGG + Intronic
1001319551 5:170668989-170669011 CAGGGACACCCAGCCCAGCCTGG - Intronic
1001603488 5:172944188-172944210 CAGGGTCACTGAGCCAGGGAGGG - Intronic
1001999840 5:176191517-176191539 CTGGGTCCCACAGCCAAGGCTGG + Intergenic
1003129917 6:3386707-3386729 CAGGGTCACCCAGCGTGGGAGGG + Intronic
1005969198 6:30748181-30748203 TGGTGTGACCCAGCCAAGGTGGG - Intergenic
1006297561 6:33176746-33176768 CAGGGTCACCCAGGGAAGGAAGG - Exonic
1007085675 6:39142968-39142990 GGAGGTCACCCAGCCAAAGTGGG - Intergenic
1007426520 6:41749589-41749611 CAGGGTCTGGCAGCCAAGCTGGG - Intronic
1007754792 6:44092338-44092360 CAAGGTCACACAGCCAGTGTTGG - Intergenic
1013138270 6:107304197-107304219 CTGGGTCACTCAACCAGGGTTGG - Intronic
1013957072 6:115853825-115853847 CAGGTTCACCAATCCAATGTAGG - Intergenic
1015874111 6:137805572-137805594 CCGGGTCTCCCAGCCAAGGCAGG - Intergenic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1017263659 6:152416945-152416967 CAGGGTCACTTAGCAAAGTTGGG - Exonic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1017941999 6:159061283-159061305 CAGGCTGACCCAGCCATGGAGGG - Intergenic
1021413579 7:20355755-20355777 CAGTGTCGCCCAGCCTAGGCTGG - Intronic
1022020730 7:26397821-26397843 CAGCATAACCCAGCTAAGGTGGG - Intergenic
1023628297 7:42138453-42138475 CAGGTTCACTGAGCCAAGCTGGG + Intronic
1023881199 7:44322699-44322721 CAGGGTCAGCCAGCCAAGAGGGG - Intronic
1032390047 7:131549927-131549949 GAGGGTCCCCCAGCTAAGGTTGG - Intronic
1032462772 7:132124133-132124155 CAAGGACACCAGGCCAAGGTAGG + Exonic
1034260336 7:149751476-149751498 CAGGGTCCCACAACTAAGGTGGG - Intergenic
1034274436 7:149817865-149817887 CAGGTTAGCCCAGCCCAGGTGGG - Intergenic
1035389968 7:158497280-158497302 CTGGGTCACCTGGCCAAGGTGGG - Intronic
1037981079 8:23254867-23254889 CAAGGTCACCCAGGCTAGGCTGG + Intronic
1039215996 8:35272297-35272319 CAGGGGAACCCAACCAAGGACGG - Intronic
1045631415 8:104128211-104128233 CAGGGTCATACAGCCAACATGGG + Intronic
1046403731 8:113743734-113743756 CAGGGTCACACAGCCAAAAACGG - Intergenic
1048826079 8:138428595-138428617 CAAGTTCACCCAGCTAATGTTGG + Intronic
1049142393 8:140967143-140967165 CAGGGTCACACAGCAAAGAAGGG + Intronic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1049668454 8:143859157-143859179 CAGGGTCCCCGAGCCAAACTCGG + Exonic
1049668873 8:143860765-143860787 CAGGGTCCCCGAGCCAAACTCGG + Exonic
1049669288 8:143862367-143862389 CAGGGTCCCCGAGCCAAACTCGG + Exonic
1049669700 8:143863960-143863982 CAGGGTCCCCGAGCCAAACTCGG + Exonic
1049670115 8:143865568-143865590 CAGGGTCCCCGAGCCAAACTCGG + Exonic
1049745235 8:144260469-144260491 CACGGTCACCTAGCCGAGGTGGG - Intronic
1056786730 9:89597887-89597909 CAAGGTCACACAGCCAATGGTGG - Intergenic
1057022363 9:91709423-91709445 CAGGGTCTCCCAGCCTCTGTGGG + Intronic
1057141018 9:92726877-92726899 CAGGGTCACCCAGCCCTCTTTGG + Intronic
1060025246 9:120165334-120165356 CAGGGTCACCCAGCTCATGAGGG - Intergenic
1060220831 9:121763302-121763324 CAGGGGCCCCCAGCCAGGGTAGG - Intronic
1061154084 9:128846675-128846697 CAGGGTCACCCAGCCAAGGTGGG - Intronic
1061315355 9:129792320-129792342 CAAGGTCAACCAGCCCAGGTTGG + Intergenic
1062441203 9:136570639-136570661 CAGGGCCACCCAGCAAGGGAAGG - Intergenic
1062466691 9:136684739-136684761 CAGGGTCCCCAAGCCAGGATGGG - Intronic
1062534847 9:137016864-137016886 CAGGGGTCCCCAGCCAGGGTTGG - Intronic
1192180251 X:68911888-68911910 CAAGGTCACTCAGCCCAGGTCGG + Intergenic
1193467765 X:81868749-81868771 CAGGTTCAGCCACCCAAGTTGGG - Intergenic
1197722654 X:129755694-129755716 CAGCCTGAACCAGCCAAGGTGGG + Intronic
1199679549 X:150215557-150215579 CAGAGTCACCCAAACCAGGTGGG + Intergenic
1199695682 X:150341492-150341514 CAGAGTCACCCAAACCAGGTGGG - Intergenic