ID: 1061154835

View in Genome Browser
Species Human (GRCh38)
Location 9:128852060-128852082
Sequence CAAACAGTGGCCACTCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061154831_1061154835 -1 Left 1061154831 9:128852038-128852060 CCCTGCAGTGTCCTGTATGGGTC 0: 2
1: 1
2: 2
3: 21
4: 143
Right 1061154835 9:128852060-128852082 CAAACAGTGGCCACTCTCTAAGG No data
1061154832_1061154835 -2 Left 1061154832 9:128852039-128852061 CCTGCAGTGTCCTGTATGGGTCA 0: 2
1: 1
2: 2
3: 10
4: 100
Right 1061154835 9:128852060-128852082 CAAACAGTGGCCACTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061154835 Original CRISPR CAAACAGTGGCCACTCTCTA AGG Intronic
No off target data available for this crispr