ID: 1061162491

View in Genome Browser
Species Human (GRCh38)
Location 9:128903199-128903221
Sequence GACCCTAGGAGGGCCTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061162485_1061162491 -4 Left 1061162485 9:128903180-128903202 CCTCTTGGGCATCAAGGATGACC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG No data
1061162475_1061162491 30 Left 1061162475 9:128903146-128903168 CCCCCATCTCTGGGATGGGGCTA 0: 1
1: 0
2: 2
3: 28
4: 419
Right 1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG No data
1061162477_1061162491 28 Left 1061162477 9:128903148-128903170 CCCATCTCTGGGATGGGGCTATA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG No data
1061162484_1061162491 1 Left 1061162484 9:128903175-128903197 CCTGGCCTCTTGGGCATCAAGGA 0: 1
1: 0
2: 0
3: 18
4: 228
Right 1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG No data
1061162478_1061162491 27 Left 1061162478 9:128903149-128903171 CCATCTCTGGGATGGGGCTATAG 0: 1
1: 0
2: 3
3: 6
4: 129
Right 1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG No data
1061162476_1061162491 29 Left 1061162476 9:128903147-128903169 CCCCATCTCTGGGATGGGGCTAT 0: 1
1: 0
2: 0
3: 35
4: 278
Right 1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061162491 Original CRISPR GACCCTAGGAGGGCCTGCAG GGG Intronic
No off target data available for this crispr