ID: 1061166380

View in Genome Browser
Species Human (GRCh38)
Location 9:128924964-128924986
Sequence GTAAATACACAAATACAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 572}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061166380_1061166386 14 Left 1061166380 9:128924964-128924986 CCTAGCTGTATTTGTGTATTTAC 0: 1
1: 0
2: 3
3: 41
4: 572
Right 1061166386 9:128925001-128925023 GTTGCACAGGTTGCTGTGGTTGG No data
1061166380_1061166384 1 Left 1061166380 9:128924964-128924986 CCTAGCTGTATTTGTGTATTTAC 0: 1
1: 0
2: 3
3: 41
4: 572
Right 1061166384 9:128924988-128925010 GGATCAAGGGTATGTTGCACAGG No data
1061166380_1061166385 10 Left 1061166380 9:128924964-128924986 CCTAGCTGTATTTGTGTATTTAC 0: 1
1: 0
2: 3
3: 41
4: 572
Right 1061166385 9:128924997-128925019 GTATGTTGCACAGGTTGCTGTGG No data
1061166380_1061166387 28 Left 1061166380 9:128924964-128924986 CCTAGCTGTATTTGTGTATTTAC 0: 1
1: 0
2: 3
3: 41
4: 572
Right 1061166387 9:128925015-128925037 TGTGGTTGGCCCAATTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061166380 Original CRISPR GTAAATACACAAATACAGCT AGG (reversed) Intronic
902125916 1:14211201-14211223 ATAAATAAACAAATAGAGATAGG - Intergenic
903609875 1:24602877-24602899 GAAAATACAAAAAATCAGCTGGG + Intronic
904022240 1:27475934-27475956 GTAAAGACATAAATAAGGCTGGG - Intronic
904723722 1:32530871-32530893 GTAAATACAATAATACAATTGGG + Intronic
904728312 1:32567417-32567439 ATTAATACACAAAAATAGCTAGG - Intronic
906413910 1:45603902-45603924 AAAAATACCTAAATACAGCTGGG - Intronic
906995626 1:50790433-50790455 TTAAAAACACAAATAAAGCCGGG - Intronic
907127234 1:52061799-52061821 AAAAATACAAAAATTCAGCTGGG - Intronic
908221957 1:62015948-62015970 AAAAATACAAAAATTCAGCTGGG - Intronic
908499433 1:64728599-64728621 GTAGATTCACAAAAACAGCCTGG + Intergenic
908993329 1:70121755-70121777 GTAAATACACAAATAAAACAGGG - Intronic
909070666 1:70990056-70990078 ATATATATACACATACAGCTGGG + Intronic
909495802 1:76277249-76277271 GTAAATACACACACACACATAGG - Intronic
909709985 1:78637774-78637796 ATAAATACATACATACATCTTGG - Intronic
909746853 1:79108219-79108241 GGAAATTCTGAAATACAGCTGGG - Intergenic
910160253 1:84264796-84264818 CTAAAAATACAAAAACAGCTGGG + Intergenic
910725578 1:90334652-90334674 ACATATACACACATACAGCTGGG - Intergenic
911075919 1:93874787-93874809 CTAAAAACACAAATCCGGCTGGG - Intronic
912976468 1:114335536-114335558 GTAAATCCACAAAAATATCTGGG + Intergenic
914262698 1:146012198-146012220 GAAAATATAAAAATACAACTAGG + Intergenic
914320624 1:146556100-146556122 GTAAATAATCAGAAACAGCTCGG + Intergenic
914415270 1:147474580-147474602 GTAAATACAACAATAAAGCCTGG + Intergenic
916597838 1:166262745-166262767 GAAAATACAAAAAAATAGCTGGG + Intergenic
916728563 1:167545642-167545664 GAAAATACAAAAAATCAGCTGGG + Intronic
916842706 1:168616095-168616117 GGAAATACACAAATAGGCCTAGG - Intergenic
916972613 1:170040984-170041006 GTAAAAATACAAAAATAGCTGGG - Intronic
917320942 1:173780888-173780910 AAAAATACAAAAAAACAGCTGGG - Intronic
917870903 1:179241061-179241083 CTAAAAATACAAAAACAGCTGGG - Intergenic
917883740 1:179364296-179364318 CTAAAAACACAAATTTAGCTGGG + Intergenic
918600277 1:186350171-186350193 GTAAATAAACAAGTACTTCTTGG - Intronic
919545718 1:198915661-198915683 TTAAATAAAGAAATAAAGCTAGG + Intergenic
920014454 1:202895230-202895252 AAAAATACAAAAATATAGCTGGG + Intronic
920106089 1:203554722-203554744 ATAAATAAACAAATAAGGCTGGG + Intergenic
920238156 1:204523304-204523326 CTAAATACACAAAATTAGCTGGG + Intronic
921107218 1:211994303-211994325 GAAAATACTGAAATACAGCAGGG - Intronic
922108805 1:222537468-222537490 GTAAATACAAAAAATTAGCTGGG + Intronic
922263443 1:223962916-223962938 CTAAATATACAAAATCAGCTGGG + Intergenic
922995033 1:229950141-229950163 ATAAATACACAAATTGAGATGGG - Intergenic
923177519 1:231481456-231481478 GTAAACACAGACATACAGATGGG - Intergenic
923416728 1:233769834-233769856 GTAGGTACACAAAGCCAGCTGGG - Intergenic
924009470 1:239648981-239649003 GTATATACACACATATAGATGGG - Intronic
924015772 1:239720112-239720134 GTAAAGACACAGATACAACACGG - Intronic
924083385 1:240422605-240422627 GCTAATACACAAATATAGCAAGG - Intronic
924511841 1:244734209-244734231 GTAAAAAAAAAAATACAGGTGGG - Intergenic
924632657 1:245755490-245755512 GCAAATAGACAAGCACAGCTGGG - Intronic
1063413418 10:5854128-5854150 ATAAATACATAAATAAAGTTAGG + Intergenic
1063475474 10:6324723-6324745 TTAAATACACATTAACAGCTGGG - Intergenic
1064060970 10:12136923-12136945 AAAAATACAAAAATTCAGCTGGG - Intronic
1064163133 10:12962930-12962952 GAAAACACACACATAAAGCTTGG - Intronic
1064412220 10:15115967-15115989 ACAAATCCACAATTACAGCTGGG + Intronic
1064947604 10:20808388-20808410 TTAAATTCTCAAATACAGCCAGG + Intronic
1065030522 10:21581339-21581361 TTAAAAACACAAATATGGCTGGG - Intronic
1065674018 10:28155228-28155250 GAAAATACCCAAATACAGATGGG + Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069132334 10:64721785-64721807 CTAAATACAAAAATATAGATTGG + Intergenic
1069217008 10:65833440-65833462 AAAAATACAAAAAAACAGCTGGG - Intergenic
1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG + Intergenic
1071604925 10:86979423-86979445 ATAAATGCAGAAATATAGCTGGG + Intronic
1071812750 10:89200896-89200918 GTACACACACAAACACAGATTGG - Intergenic
1072335850 10:94397542-94397564 GAAAATACAGAAAAATAGCTGGG - Intergenic
1072531040 10:96319581-96319603 GGAAATAGACAAATACATTTAGG + Intronic
1073489352 10:103842504-103842526 ATGAATACAAAAATACAGTTGGG - Intronic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073721338 10:106175841-106175863 GTGAATTCACAAATGCAGTTTGG - Intergenic
1073880924 10:107978961-107978983 GTCCATACTCAAATCCAGCTTGG - Intergenic
1073912548 10:108363310-108363332 GCAACTACACAAATATAGCATGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1075600883 10:123768407-123768429 ATAAATAAATAAATAAAGCTCGG + Intronic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1075959033 10:126551055-126551077 CTAAATACACAAATACTCCAAGG + Intronic
1076015705 10:127025893-127025915 CTAAATACACAAAATTAGCTGGG + Intronic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1077255275 11:1578994-1579016 ATAAATCCACAAATACAATTGGG - Intergenic
1077748909 11:4941430-4941452 GTAAATACACAAACACATACGGG + Intronic
1077804881 11:5580470-5580492 GAAAATACAAAAAATCAGCTGGG - Intronic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078352549 11:10606440-10606462 TTAGATACACAAAACCAGCTGGG - Intronic
1079924517 11:26477366-26477388 CTCCATACACAAATACATCTGGG - Intronic
1080313735 11:30924910-30924932 GAAAATACAAAAAATCAGCTAGG + Intronic
1080538677 11:33245812-33245834 GTAAATAAATAAATAAAGCCAGG - Intergenic
1080948478 11:37001658-37001680 GAAAATACAAAAATATAGATGGG - Intergenic
1081340297 11:41919163-41919185 GCAAATACACACATACACTTAGG + Intergenic
1081876767 11:46413922-46413944 GGAACTACACAAATACACCAAGG + Intronic
1082131371 11:48493479-48493501 ATATATACAGAAATACAGTTAGG + Intergenic
1082245434 11:49916652-49916674 ATATATACAGAAATACAGTTAGG - Intergenic
1082564864 11:54664356-54664378 ATATATACAGAAATACAGTTAGG + Intergenic
1083373877 11:62204178-62204200 AAAAATACAAAAATATAGCTGGG + Intergenic
1083628334 11:64083273-64083295 TAAAATACAAAAAAACAGCTGGG + Intronic
1084015382 11:66376639-66376661 GCAAATACACAAAATCAGCTGGG - Intergenic
1084451021 11:69238563-69238585 TTAAATACACATATACACATAGG - Intergenic
1084859439 11:72008735-72008757 GTCAATACTCAAGTCCAGCTGGG + Exonic
1085801756 11:79596252-79596274 GAAAATACAAAAAAATAGCTGGG + Intergenic
1086130594 11:83397689-83397711 AAAAATACAAAAATACAGCAGGG - Intergenic
1086474024 11:87150844-87150866 GTAAATCCAAAAAGACAACTGGG - Intronic
1087006302 11:93475476-93475498 ATGAATACACAAACACATCTTGG + Intergenic
1087191989 11:95264648-95264670 GAAAAAACAAAAAAACAGCTGGG + Intergenic
1089082150 11:115785456-115785478 GTGTACACACAAATACAGCTGGG - Intergenic
1090336683 11:125973235-125973257 TTAAAAACCCAAATTCAGCTGGG + Intronic
1090602541 11:128388258-128388280 CAATGTACACAAATACAGCTGGG - Intergenic
1090744698 11:129696419-129696441 GGAACTACACAATTACAGTTGGG - Intergenic
1091499486 12:1002019-1002041 TAAAATACAAAAAAACAGCTGGG - Intronic
1093505696 12:19863119-19863141 GTAAATAGACTGACACAGCTGGG - Intergenic
1093797303 12:23327656-23327678 GTGAATATTCAAAAACAGCTGGG + Intergenic
1094278706 12:28709654-28709676 ATAAACACACATATAGAGCTAGG - Intergenic
1094554793 12:31487889-31487911 GAAAACAAACAAAAACAGCTGGG + Intronic
1095174554 12:39076318-39076340 TAAAATATACAAATACAGCTGGG - Intergenic
1095750908 12:45709891-45709913 GCAAATATACAATTACAGCCAGG + Intergenic
1095985816 12:47998880-47998902 ATAAAAACACAAAAACAGCAAGG + Intronic
1096134178 12:49185850-49185872 GTAAATAGAGAACTCCAGCTTGG + Exonic
1097256139 12:57675919-57675941 GAAAATACAAAAAATCAGCTGGG - Intergenic
1098186211 12:67899588-67899610 GCAAATGCACAAATACTTCTCGG + Intergenic
1099095768 12:78372422-78372444 GTAAAAATACAAAAATAGCTGGG + Intergenic
1100030842 12:90189000-90189022 GTCATTACACAAATACTGCTGGG - Intergenic
1100889948 12:99114379-99114401 GTAAATAGACAACTACAGAATGG + Intronic
1101305350 12:103522389-103522411 GTGAATGGACTAATACAGCTGGG + Intergenic
1101465871 12:104948920-104948942 ATAAATGAACAAATACGGCTGGG + Intronic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1102442317 12:112972660-112972682 GTAAATAGACCAATGCAGTTAGG + Exonic
1102489481 12:113281199-113281221 CTAAAAATACAAAAACAGCTGGG - Intronic
1102975731 12:117205987-117206009 AAAAATACAAAAATACAGCCGGG - Intergenic
1103038427 12:117675142-117675164 GTAAATGCAGAATTCCAGCTGGG - Intronic
1103094947 12:118125361-118125383 AAAAATACAAAATTACAGCTGGG - Intronic
1103178853 12:118890024-118890046 GAAAATACAAAAAAATAGCTGGG - Intergenic
1103248458 12:119478766-119478788 CTAAAAATACAAAAACAGCTGGG - Intronic
1103282849 12:119774811-119774833 GAAAATACAGAAAATCAGCTGGG + Intronic
1103384396 12:120520628-120520650 AAAAATACAAAAATTCAGCTGGG - Intronic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1103988361 12:124781880-124781902 ATAAATAAATAAATACATCTGGG - Intronic
1104487565 12:129164485-129164507 GAAAATGGACCAATACAGCTGGG - Intronic
1104505775 12:129330817-129330839 GAAAATAGACAAATACACCAAGG + Intronic
1105053406 12:133075813-133075835 GTAAATACAAAAAATTAGCTGGG + Intergenic
1105479854 13:20764605-20764627 ACAAATCCACAATTACAGCTGGG - Intronic
1105746837 13:23385096-23385118 CTAAAAATACAAATACAGCCTGG + Intronic
1106063438 13:26319306-26319328 AAAAATACAAAAAAACAGCTGGG + Intronic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1107280441 13:38727321-38727343 AAAAATACAAAAATACAGCGTGG + Intronic
1108391713 13:49953614-49953636 GTAAATAAATAAATAAAGCTGGG - Intergenic
1108556260 13:51595820-51595842 GTAAATATATAAATAAAGGTGGG + Intronic
1108978315 13:56478327-56478349 GTAAATCCAGAAAAACTGCTAGG - Intergenic
1110465119 13:75791673-75791695 ATAAATACAAAAATAAAGCACGG + Intronic
1110697219 13:78504872-78504894 AAAAATACACATATACGGCTGGG - Intergenic
1110746875 13:79064384-79064406 GTCAAGATACAAATACAGATTGG + Intergenic
1112030081 13:95448898-95448920 GTAAAAATACAAAAATAGCTGGG - Intronic
1112327675 13:98453860-98453882 GTACATACAAAATTACAGATTGG + Intronic
1114955045 14:27806529-27806551 GAAAACAGACTAATACAGCTAGG + Intergenic
1115122367 14:29952821-29952843 GTAAATACAAAAATTCAGGTGGG - Intronic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1116173907 14:41440432-41440454 GTAAAACCACAAGTACAGGTTGG + Intergenic
1116405258 14:44558656-44558678 TTAAAAAAACAAATACTGCTGGG - Intergenic
1116635337 14:47387419-47387441 GGGAATACACCAAAACAGCTGGG + Intronic
1116854875 14:49943360-49943382 GAAAATAGACTAATACAGCTGGG + Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117878226 14:60279036-60279058 GTAAATACAAATATACACTTGGG + Intronic
1117902796 14:60552413-60552435 CTAAATACACAAATTAAGATAGG - Intergenic
1117918565 14:60704242-60704264 CTAAATACACAAAATTAGCTGGG + Intergenic
1118516658 14:66537115-66537137 GTAAATACAAGAATATAGATTGG - Intronic
1118614372 14:67565235-67565257 GTAAATAAATAAATAAAGCCTGG - Intronic
1118626248 14:67661993-67662015 GAAAATACAAAAAAACAGCCAGG + Intronic
1119083554 14:71719652-71719674 CTAAAAACACAAAAATAGCTGGG - Intronic
1121131253 14:91449578-91449600 AAAAATACAAAAAAACAGCTGGG + Intergenic
1121806226 14:96826313-96826335 TTAAATACACAAAGCAAGCTTGG - Intronic
1122103567 14:99433596-99433618 GAAAATACAAAAAATCAGCTGGG - Intronic
1123898761 15:24854837-24854859 CTAAAAACACAAATTTAGCTGGG + Intronic
1124686377 15:31786258-31786280 GAAAACAAACTAATACAGCTGGG + Intronic
1124700506 15:31908176-31908198 AAAAATACAAAAAAACAGCTGGG - Intergenic
1125411755 15:39413560-39413582 GTAAATACACAAATAAGGCTTGG + Intergenic
1126334959 15:47576934-47576956 GTACCTACAGAAATACATCTTGG + Intronic
1126727188 15:51643800-51643822 ATAAATACACAAAGACATTTTGG + Intergenic
1128025445 15:64432614-64432636 ATAAATAAATAAATACAGCCGGG + Intronic
1128041276 15:64575661-64575683 GTAAATATACAAATACTACCTGG - Intronic
1128101642 15:65005767-65005789 CTAAATACAAAAATTTAGCTGGG - Intronic
1129072993 15:72967003-72967025 CTAAATATTCAAATAGAGCTTGG + Intergenic
1129632844 15:77280178-77280200 GTAAATACACAAAATTAGCTGGG + Intronic
1130181802 15:81637253-81637275 GTGAAAACACTAATACAGTTAGG + Intergenic
1130773872 15:86955543-86955565 GTAAAAATAAAACTACAGCTTGG + Intronic
1131172218 15:90186456-90186478 GTAAAAACACAAAATTAGCTGGG + Intronic
1131346514 15:91654383-91654405 CTAAAAACACAAAAATAGCTGGG + Intergenic
1131396266 15:92088987-92089009 ATAAATAAATAAATAAAGCTGGG - Intronic
1131646181 15:94347649-94347671 GTAAATACATAAAGAGAACTAGG - Intronic
1132005625 15:98223842-98223864 TAAAATACAAAAAAACAGCTGGG + Intergenic
1132145786 15:99428708-99428730 GTATATACACACATACAGCAAGG - Intergenic
1132261756 15:100431792-100431814 GTTAATAGAAAAATACAGCCAGG - Intronic
1132369245 15:101282113-101282135 GGAAATACTCAAAAACATCTGGG + Intronic
1132740043 16:1407533-1407555 AAAAATACAAAAATTCAGCTGGG + Intronic
1133014897 16:2935082-2935104 CTAAATATACAAAAATAGCTGGG - Intronic
1133791139 16:9010056-9010078 AAAAATACACGAATACAGCTTGG - Intergenic
1133824658 16:9267332-9267354 TTAAATACACAAATACAGGCTGG + Intergenic
1134661506 16:15987945-15987967 ATAAATAAACAAATACAGGATGG - Intronic
1134804161 16:17110617-17110639 GAGAACAGACAAATACAGCTAGG + Intronic
1135391486 16:22097124-22097146 AAAAATACACAAAATCAGCTGGG - Intronic
1137002732 16:35244868-35244890 GAAAATATACAAATATACCTTGG - Intergenic
1137999804 16:53265101-53265123 CTAAATATATTAATACAGCTGGG + Intronic
1138437164 16:57009296-57009318 ATAAATAAATAAATAAAGCTGGG + Intronic
1138965488 16:62079161-62079183 GAAAATAAACAAATACATCCTGG - Intergenic
1139035575 16:62942059-62942081 GAAAATACAAAAAAATAGCTGGG - Intergenic
1139055236 16:63175170-63175192 ATAAATACAACAATACAGGTTGG - Intergenic
1139540676 16:67613613-67613635 GAAAATACAAAAAATCAGCTGGG + Intronic
1139554173 16:67695959-67695981 ATATATACCCAAATACAACTAGG - Intronic
1140012909 16:71154005-71154027 GTAAATAATCAGAAACAGCTCGG - Intronic
1140332529 16:74071784-74071806 GTCAGTACAGAAATAGAGCTGGG + Intergenic
1140854443 16:78965407-78965429 GTAAATACAAAAAATTAGCTGGG + Intronic
1141971425 16:87486355-87486377 TTAGATACACAAATACCACTGGG + Intronic
1142835316 17:2581512-2581534 CTAAATATACAAAATCAGCTGGG + Intergenic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1146204396 17:30889762-30889784 GTAAATACACAAATATTTCAAGG + Intronic
1147275756 17:39315090-39315112 GCAAATACAAAAATTAAGCTGGG - Intronic
1147444747 17:40468041-40468063 GAAAATACAAAAAAATAGCTGGG - Intergenic
1147455892 17:40537896-40537918 TTAAATACAAAAATTTAGCTAGG + Intergenic
1147596309 17:41720182-41720204 ATAAATAAATAAATAAAGCTGGG - Intronic
1147648401 17:42048150-42048172 GGAAATACACAAACCCAGCCTGG + Intronic
1148243539 17:46015362-46015384 ATAAAAATAAAAATACAGCTGGG + Intronic
1148814297 17:50315567-50315589 AAAAATACAAAAAAACAGCTGGG + Intergenic
1149075103 17:52587405-52587427 GAAAACACACACATGCAGCTGGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1149509065 17:57222931-57222953 GTAAACACACAAATAGGTCTGGG + Intergenic
1150810278 17:68350814-68350836 ATAAATACATAAATAAAGCTTGG + Intronic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151913913 17:77103600-77103622 TAAAATACACAAAATCAGCTGGG - Intronic
1151984132 17:77531189-77531211 GTAAACACACAATTACAGTAGGG - Intergenic
1152393442 17:80016780-80016802 GGAAATACACAAACAGGGCTGGG - Intronic
1152442713 17:80318732-80318754 AAAAATACAAAAATATAGCTGGG - Intronic
1153122294 18:1743527-1743549 GTAAATATGCAAAAAGAGCTGGG - Intergenic
1153841429 18:9011523-9011545 ATAAACACGCACATACAGCTGGG + Intergenic
1154239258 18:12637522-12637544 GTAAATACACTGATATTGCTGGG + Intronic
1155234681 18:23807303-23807325 TTAAATTCATAAATACAGGTAGG - Intronic
1156277917 18:35602377-35602399 ATAAATACACAGATACAGGAAGG - Intronic
1156977558 18:43242039-43242061 GTAAATAAACAAATAGAAATAGG + Intergenic
1157321526 18:46638470-46638492 GTAAATACAAAAAATTAGCTGGG + Intronic
1157612283 18:48964934-48964956 GTACATACACACATACACATTGG + Intergenic
1158130101 18:54142937-54142959 GAAAATAGACTAATACAACTGGG + Intergenic
1159147755 18:64476615-64476637 GCAAATACAAAAATAGTGCTGGG + Intergenic
1159386144 18:67727525-67727547 GAAAATACACACACACAGCCGGG + Intergenic
1159788040 18:72738826-72738848 GTAGATACACACATAGAGTTTGG - Intergenic
1160087718 18:75794025-75794047 GTAAATAAATAAATAAAGTTAGG - Intergenic
1160114382 18:76063990-76064012 GTAAATATACAAAATTAGCTGGG - Intergenic
1160290291 18:77586808-77586830 GAAAATAGACTAATACACCTGGG + Intergenic
1160917046 19:1501888-1501910 GTAAATAAATAAAAAGAGCTGGG - Intergenic
1161336230 19:3715248-3715270 AAAAATACAAAAATATAGCTGGG - Intronic
1161342251 19:3749639-3749661 TTAAACACCCAACTACAGCTGGG - Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162716779 19:12639356-12639378 ATAAATACAAAAAAACAGCCGGG - Intronic
1163067325 19:14807733-14807755 AAAAATACAAAAATTCAGCTGGG + Intronic
1163957237 19:20654949-20654971 ATAAATACAAAAATTCAGCCAGG + Intronic
1164392987 19:27841773-27841795 AAAAATACAAAAATATAGCTGGG - Intergenic
1164559756 19:29282424-29282446 ATAAATAAATAAATAAAGCTAGG + Intergenic
1165891462 19:39114933-39114955 GTAAAAATACAAATTTAGCTGGG + Intergenic
1167382600 19:49147388-49147410 AAAAATAAACAAATACAGCCAGG + Intronic
1167513022 19:49906505-49906527 GAATATACACAAATATGGCTGGG - Intronic
1167694199 19:51004537-51004559 GAAAATACAAAAAATCAGCTGGG + Intronic
1168033699 19:53702087-53702109 AGAAATACACAAGTACAGGTGGG - Intergenic
1168038089 19:53736361-53736383 ATAAATACACAAGTACAGGTGGG - Intergenic
1168123609 19:54270467-54270489 GTATATACACACACACAGCACGG - Intronic
1168198988 19:54800015-54800037 CTAAAAATACAAAAACAGCTGGG + Intronic
1168225008 19:54988439-54988461 AGAAATACAAAAATACAGGTGGG - Intronic
1168256668 19:55169926-55169948 ATAAATAAATAAATACAGCCGGG - Intergenic
1168378072 19:55897357-55897379 ATAAATACAAAAAAACAGATGGG + Intronic
1168572063 19:57479315-57479337 GTAAATAAATAAATAAAGCCAGG - Intergenic
925550935 2:5073730-5073752 AAAAATACAAAAATATAGCTGGG + Intergenic
926401749 2:12504157-12504179 TCAAATACACCAACACAGCTCGG - Intergenic
926433376 2:12814099-12814121 TTAGATACACAAATACAGTGAGG - Intergenic
926693886 2:15757143-15757165 GTAAATCCACAAAAGCAGGTTGG + Intergenic
927616947 2:24607908-24607930 GTAAATAAGAAAATACAGGTAGG - Intronic
927781706 2:25944671-25944693 GAAAATATGCAAATACATCTGGG - Intronic
928298369 2:30105044-30105066 CTAAAAACACAAAATCAGCTGGG - Intergenic
928340847 2:30441921-30441943 GAAAATAAAAAAATACAGCCGGG + Intergenic
928500352 2:31886389-31886411 GTAAATACACACATACATATAGG - Intronic
928510499 2:31998637-31998659 AAAAATACAAAAATTCAGCTGGG + Intronic
928568460 2:32578633-32578655 AAAAATACAAAAATTCAGCTGGG + Intronic
928740787 2:34349878-34349900 TCAAATACAGAAATAAAGCTTGG + Intergenic
928762301 2:34599104-34599126 GTAAATACAAAATTCCAGGTGGG - Intergenic
929423666 2:41820921-41820943 AAAAATACAAAAATATAGCTGGG - Intergenic
930550156 2:52823987-52824009 ATAAAAACACATACACAGCTGGG + Intergenic
930946033 2:57076830-57076852 TTAATTACATAAACACAGCTTGG - Intergenic
931732024 2:65161719-65161741 ATAAATAGACAAATATGGCTGGG - Intergenic
932974693 2:76585021-76585043 CTAAAAACACAAAATCAGCTGGG - Intergenic
933520355 2:83363956-83363978 CTAAATACACAAAATTAGCTGGG - Intergenic
934482301 2:94662992-94663014 GAAAACAGACCAATACAGCTAGG - Intergenic
934750509 2:96790822-96790844 AAAAATACAAAAATCCAGCTGGG + Intronic
934861695 2:97768945-97768967 GTAAATAAATAAATAAAGCCTGG - Intronic
935460598 2:103328651-103328673 CTAAAAATACAAAAACAGCTGGG - Intergenic
937381778 2:121383836-121383858 GCTAATACACAAATACCACTTGG - Intronic
938082064 2:128375429-128375451 TTAACTAAACAAATACAACTGGG + Intergenic
938870635 2:135472337-135472359 AAAAATACAAAAATATAGCTGGG + Intronic
939751086 2:146046873-146046895 TTTAATAAATAAATACAGCTAGG + Intergenic
939996453 2:148925198-148925220 ATAAACACACAAATTCTGCTTGG + Intronic
940214756 2:151293047-151293069 GTAAATAAATAAATAAAGCATGG + Intergenic
940431454 2:153595013-153595035 GTAATTACAAAAATAAATCTTGG + Intergenic
940731216 2:157394961-157394983 TTTAAATCACAAATACAGCTGGG + Intergenic
941306900 2:163881070-163881092 ATAACTACACAATTGCAGCTGGG - Intergenic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
942250589 2:174044438-174044460 GCAAAGATACAAATACAGATTGG + Intergenic
942294426 2:174504175-174504197 CTAAAAACACAAAAATAGCTGGG - Intergenic
942387468 2:175457573-175457595 GTAGACACAGAAATACAGATAGG - Intergenic
942439854 2:176021114-176021136 GAAAATACAAAAAAATAGCTGGG + Intergenic
944446076 2:199790822-199790844 ATAAAGATACAAATACTGCTAGG + Intronic
944459813 2:199936281-199936303 ATATATACACAAATACAATTAGG + Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
945574205 2:211509354-211509376 ATAAATAAACAAATAAAACTGGG + Intronic
946470417 2:219955330-219955352 ATAAATAGAAAAATACAGCTAGG - Intergenic
946799184 2:223392073-223392095 CTAAATATACAAAATCAGCTGGG - Intergenic
947116313 2:226775084-226775106 GCAAATAAAAAAATACACCTAGG + Intronic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947453320 2:230228767-230228789 GTAAATATAAAAATACAGATAGG - Intronic
947720955 2:232368979-232369001 GCAAAAACCCAAAAACAGCTGGG - Intergenic
947893355 2:233645548-233645570 GTAAATACACCATTCCAACTGGG + Intronic
1168776129 20:449005-449027 AAAAATACAAAAATATAGCTGGG - Intronic
1168900104 20:1356370-1356392 ATAAATCCACAATTACAGCGTGG - Intronic
1169070024 20:2720255-2720277 AAAAATACAAAAATTCAGCTGGG - Intronic
1171890490 20:30708442-30708464 CTAAATACAAAAAAATAGCTGGG + Intergenic
1171985261 20:31656001-31656023 GTAAAAATACAAATTTAGCTGGG + Intergenic
1172038091 20:32024528-32024550 ATAAATACACAACCACAGGTTGG + Intronic
1172194972 20:33085459-33085481 ATAAATACATAAATAAATCTGGG + Intronic
1172675926 20:36672017-36672039 GTAAATACAGAAATACAGACAGG - Intronic
1172808498 20:37630642-37630664 GAAAAAACACATAGACAGCTAGG - Intergenic
1172830697 20:37831659-37831681 AGAAATAAACAACTACAGCTGGG - Intronic
1173364476 20:42372442-42372464 GAAAATATACAAATTTAGCTAGG - Intronic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1173657885 20:44713461-44713483 TTAAACACAGAAATACAGCTGGG - Intergenic
1173676777 20:44842895-44842917 CTAAAAATACAAAAACAGCTGGG - Intergenic
1174004488 20:47399711-47399733 ACAAATACACATATACAGCCAGG - Intergenic
1174166230 20:48585516-48585538 GTAAAGACTTAAATCCAGCTGGG + Intergenic
1174699350 20:52591650-52591672 GCAAATACACAAATACATAGTGG - Intergenic
1174801944 20:53571563-53571585 AAAAATACACAAATTTAGCTGGG - Intronic
1175024236 20:55884788-55884810 GAAAACAGACAAATACAGATGGG + Intergenic
1175098076 20:56557916-56557938 CTAAATACACAAAATTAGCTGGG + Intergenic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1176732861 21:10518111-10518133 AAAAATACAAAAATTCAGCTGGG + Intergenic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177145029 21:17398112-17398134 GTAAAAACAAAAATAAAGATGGG + Intergenic
1177249332 21:18571597-18571619 TTACATACAAAAATACAGTTTGG + Intergenic
1177679491 21:24347399-24347421 GAAAATACACAAAATTAGCTGGG - Intergenic
1177745054 21:25202309-25202331 GTAAATATACAAATAGAGTCAGG + Intergenic
1177822396 21:26045821-26045843 GCAAATGAACTAATACAGCTCGG - Intronic
1177935418 21:27339084-27339106 AAAAATACAAAAAAACAGCTGGG + Intergenic
1179143930 21:38751300-38751322 CTAAAAATACAAATATAGCTGGG + Intergenic
1179285140 21:39970910-39970932 TTAAATACACACATACAAGTTGG + Intergenic
1179660590 21:42872282-42872304 GTAAAAACCCAAATTCAGCTGGG - Intronic
1180739545 22:18043322-18043344 AAAAATACAAAAATATAGCTGGG + Intergenic
1180739963 22:18046492-18046514 AAAAATACAAAAATATAGCTGGG - Intergenic
1181927451 22:26371470-26371492 GAATATACACAAATGTAGCTGGG + Intronic
1182700792 22:32236364-32236386 GATAATACACAAATATAGGTTGG - Intronic
1182950104 22:34366024-34366046 GTACATACACATATACATCATGG - Intergenic
1182982817 22:34687564-34687586 GTAAATAAATAAATGCTGCTAGG + Intergenic
1183536794 22:38406644-38406666 GAAAAAAGAGAAATACAGCTGGG - Intergenic
1183718914 22:39550830-39550852 GTACATACACACACACAGCGGGG + Intergenic
1183766615 22:39882707-39882729 GAAAATACACAAAGAGGGCTGGG + Intronic
1183859552 22:40659942-40659964 ATAAATACAAAAAATCAGCTGGG - Intergenic
1184134824 22:42541656-42541678 CTAAAAATACAAAAACAGCTGGG - Intergenic
1184693921 22:46129551-46129573 GTAAATGCGGAAATACGGCTTGG + Intergenic
1184975109 22:48056044-48056066 GGAAATACATACATACATCTCGG - Intergenic
1185256469 22:49835870-49835892 AAAAATACACAAATATAGCCAGG + Intergenic
949233628 3:1781933-1781955 CTAAAAACACAAAAATAGCTGGG - Intergenic
949302135 3:2596201-2596223 GTAAATACATAAATCAAGGTGGG - Intronic
949999546 3:9646338-9646360 AAAAATACAAAAAAACAGCTGGG - Intergenic
950087748 3:10272597-10272619 GTAAATACAAAAAATTAGCTGGG - Intronic
950981385 3:17309963-17309985 GTTAATACACAACTACAGTTAGG + Intronic
951693108 3:25417696-25417718 GAAAATAGACTAATACAGCCTGG + Intronic
953268278 3:41414334-41414356 GTGAATACACACATACAACTTGG + Intronic
953329555 3:42041473-42041495 ACAAATACACAAATTCAGCAAGG - Intronic
953343370 3:42154724-42154746 TTAAATAAACAAATAAGGCTGGG - Intronic
953632899 3:44634743-44634765 ATAAATAAGAAAATACAGCTGGG - Intronic
954033799 3:47839453-47839475 CTAAAAACACAAAATCAGCTGGG - Intronic
954337323 3:49927072-49927094 ATAAAAACACAAGTTCAGCTGGG - Intronic
954489998 3:50894935-50894957 CCAAATAGTCAAATACAGCTGGG - Intronic
955184542 3:56702424-56702446 GAAAATACAAAAATATAGCCAGG + Intergenic
955656312 3:61248677-61248699 ATAAACACACAAATAAAGATGGG + Intronic
957121136 3:76094432-76094454 GTCAATAACGAAATACAGCTGGG + Intronic
958537387 3:95421873-95421895 TTAACTACACAAATATATCTAGG + Intergenic
960224228 3:115150096-115150118 GATAATACAAAAAAACAGCTGGG + Intergenic
960540748 3:118859721-118859743 ATGAATACACAAGTACAGCCAGG - Intergenic
960678481 3:120221822-120221844 AAAAATACAAAAATACAGCCAGG - Intronic
960778933 3:121295579-121295601 GAAAATTCACACATACTGCTAGG - Intronic
960976853 3:123184202-123184224 GAAAATACAAAAATTCGGCTGGG + Intronic
961064305 3:123861597-123861619 GTAAATGGCCAAAGACAGCTTGG - Intronic
961151550 3:124642609-124642631 GCACACACACAAATACAGCCTGG - Intronic
961561151 3:127731169-127731191 GTAAATACATAAATAAAACCAGG - Intronic
962342078 3:134594268-134594290 GTGAGTACACAAGAACAGCTGGG - Intergenic
962490824 3:135892646-135892668 GAAAATACAAAAAAAAAGCTGGG + Intergenic
962556293 3:136555520-136555542 CTAAAAATACAAAAACAGCTGGG + Intronic
963510331 3:146239720-146239742 CTAAAAATACAAAAACAGCTGGG + Intronic
963724457 3:148904552-148904574 CTAAATACACAAAATTAGCTGGG + Intergenic
964217456 3:154302580-154302602 GAAAATACAGAACTACAGTTAGG + Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
966058324 3:175724313-175724335 GTAAAGACAAAAATAAATCTTGG + Intronic
966659753 3:182401259-182401281 GTAATTACAGAAATGCAGCCGGG + Intergenic
966967371 3:185007777-185007799 GTAAATGTACAAATAATGCTAGG + Intronic
967547676 3:190751127-190751149 CTAAATATACAAAAATAGCTGGG - Intergenic
967683432 3:192392433-192392455 ATAAATAAATAAATAAAGCTGGG + Intronic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
968837876 4:2978932-2978954 GAAAATACACAAATTAGGCTGGG + Intronic
969074861 4:4569901-4569923 GAAAACAGACAAATACAGATAGG - Intergenic
969981918 4:11166435-11166457 ATAAATACACATATACTGTTTGG - Intergenic
970078538 4:12252927-12252949 GCAAATACATAAGTGCAGCTAGG + Intergenic
971054683 4:22898950-22898972 GTTAAACCACAACTACAGCTAGG - Intergenic
971938113 4:33179810-33179832 GTAAATACACACACACAACATGG + Intergenic
972292331 4:37701102-37701124 GTACAGACACATATACAACTGGG - Intergenic
972392127 4:38623688-38623710 CTAAATACACAAAATTAGCTGGG - Intergenic
973578721 4:52319489-52319511 ATAAGTACAAAATTACAGCTTGG - Intergenic
973967653 4:56180326-56180348 CTAAAAACACAAAAACAGCTGGG + Intronic
975879724 4:78889729-78889751 GTATATACACACATACACCTGGG - Intronic
976471928 4:85438919-85438941 ACAAATACAAAACTACAGCTAGG - Intergenic
977481210 4:97578263-97578285 AAAAATACACAAATTTAGCTGGG - Intronic
978066477 4:104409756-104409778 TTAAATACACAATTACATGTAGG + Intergenic
978197432 4:105987726-105987748 GTTAATACAAAATTGCAGCTGGG - Intronic
978399022 4:108311685-108311707 GGAAATACAAAAATACACCAGGG - Intergenic
978469650 4:109049982-109050004 ATAAATAAACAAATACAACTAGG + Intronic
979268913 4:118736164-118736186 CTAAAAATACAAAAACAGCTGGG - Intronic
979467435 4:121056967-121056989 GTAATTCCACAAATACAAGTAGG + Intronic
979731615 4:124029810-124029832 CTAAATACACAAAATCAGCCAGG - Intergenic
980567042 4:134555999-134556021 GGAAATACACCTACACAGCTTGG - Intergenic
980990187 4:139732902-139732924 ATAAATACACAAAGACAGCTAGG + Intronic
981032490 4:140139394-140139416 TTAAAAACAAAAATCCAGCTGGG + Intronic
981304339 4:143230316-143230338 GAAAATACACAAAATTAGCTGGG - Intergenic
982191394 4:152859220-152859242 AAAAATACAAAAATTCAGCTGGG - Intronic
982506703 4:156227709-156227731 ATGAATACACAAATTCAGATGGG + Intergenic
984170791 4:176357148-176357170 AGACATACACAAACACAGCTTGG + Intergenic
984527735 4:180876645-180876667 GCACACACACAAATACAGTTTGG + Intergenic
984537067 4:180989722-180989744 TTAAATTCACAAATATAGGTAGG + Intergenic
984565562 4:181326043-181326065 GTATATACAGAAATAGGGCTGGG + Intergenic
984872929 4:184343299-184343321 GTAAGCCCACAAATGCAGCTGGG + Intergenic
984943964 4:184956795-184956817 CTAAATACAAAAAACCAGCTGGG + Intergenic
984995792 4:185428410-185428432 CTAAAAATACAAAAACAGCTGGG + Intronic
985239830 4:187918207-187918229 GTATACACAAAAATACACCTTGG - Intergenic
985276372 4:188241844-188241866 CTAAATACACAAAGTTAGCTGGG - Intergenic
986178290 5:5370343-5370365 GTAAATAAACAAAAACACCAGGG - Intergenic
986622150 5:9687263-9687285 ATAAATACAGGAAGACAGCTGGG - Intronic
986636806 5:9830303-9830325 ATATATACAGAAATACAGATAGG + Intergenic
986761477 5:10883645-10883667 TTAAATACACAGATATAGATAGG + Intergenic
987285143 5:16448718-16448740 GAAAATACACAAAATTAGCTGGG - Intergenic
987499666 5:18692421-18692443 GTATATTCAGAAATACAACTTGG - Intergenic
987943479 5:24573158-24573180 ATAAATATATAAATAGAGCTCGG + Intronic
987978906 5:25054234-25054256 GAAAATAAACAAATAAGGCTGGG + Intergenic
988170472 5:27648658-27648680 AAAAATACAAAAATTCAGCTGGG - Intergenic
988386477 5:30572634-30572656 GCAAATACAGAAATACATCAAGG + Intergenic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989287327 5:39716852-39716874 GTAAACAAACAGAAACAGCTAGG - Intergenic
989609577 5:43278204-43278226 TTAAAAACACAAAATCAGCTAGG - Intronic
990335696 5:54770114-54770136 ATAAATACACAAATAGACATGGG + Intergenic
991137806 5:63203676-63203698 ATAGATACAAAATTACAGCTGGG - Intergenic
991200310 5:63984492-63984514 CTAAATAGACAAGTACGGCTAGG + Intergenic
992342128 5:75835349-75835371 ATAAAACCACAAATACAACTGGG - Intergenic
993043378 5:82840423-82840445 TTAAAAACACAAAAACTGCTTGG - Intergenic
994262328 5:97674598-97674620 GTAAATAGACAACTACATCATGG - Intergenic
994781088 5:104090940-104090962 TTAAAAACACAAATACAGCTAGG + Intergenic
995568342 5:113454761-113454783 ATGAATACACATATACATCTTGG + Intronic
995581176 5:113604644-113604666 CAATATACAGAAATACAGCTGGG - Intergenic
996026477 5:118651866-118651888 ATAAGCACATAAATACAGCTTGG - Intergenic
996353306 5:122569728-122569750 GCAAATACACAAATTCAACTGGG - Intergenic
997775169 5:136597581-136597603 CTAAATACACAAAATTAGCTGGG - Intergenic
998608786 5:143665203-143665225 CTAAACACAGGAATACAGCTGGG - Intergenic
998888108 5:146716177-146716199 GTAAATACACAAATCCTTCAAGG + Intronic
999685778 5:154101788-154101810 GAAAATACAAAAAAAAAGCTGGG + Intronic
1000876683 5:166647949-166647971 CTAAATGAACCAATACAGCTAGG + Intergenic
1001146369 5:169188116-169188138 AAAAATACAAAAATATAGCTAGG - Intronic
1001573630 5:172747529-172747551 GTAAATAAATAAATACAGGGAGG - Intergenic
1001638962 5:173232160-173232182 GTAAAAACATAAATACGGGTGGG + Exonic
1001910337 5:175511945-175511967 GGAAATATACAAATACTGCTAGG + Intronic
1002039734 5:176504000-176504022 GAAAATACAAAAATACAGAATGG + Intronic
1002145690 5:177179374-177179396 CTAAAAACACAAAATCAGCTGGG - Intronic
1002867377 6:1134010-1134032 ATTAATACAAAATTACAGCTAGG - Intergenic
1002874237 6:1197378-1197400 GTAAATACACAAATATTCCCCGG - Intergenic
1003235424 6:4291140-4291162 CTTAAAACACAAACACAGCTAGG - Intergenic
1004309301 6:14530302-14530324 TAAAATACAAAAAAACAGCTGGG - Intergenic
1004629052 6:17404442-17404464 GAAAATACAAAAAAATAGCTGGG + Intronic
1004862120 6:19815158-19815180 GAAAATACACAAATAGAGATTGG + Intergenic
1005073885 6:21888426-21888448 GTAAATACAAAAAATTAGCTGGG - Intergenic
1005195492 6:23278556-23278578 TTAAATATACAAATACATGTAGG - Intergenic
1005237414 6:23780794-23780816 GTAGATACACACATATAGATAGG + Intergenic
1007119430 6:39367886-39367908 GTAAAAGCACACAGACAGCTGGG + Intronic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1007534635 6:42575052-42575074 CTACATACATAAATACAGATGGG + Intronic
1007566405 6:42854341-42854363 AAAAATACAAAAAAACAGCTGGG - Intronic
1008326808 6:50192261-50192283 GGAAATAGACAAATAAATCTGGG - Intergenic
1008411283 6:51183033-51183055 GTAAATACACAAATCTACATGGG - Intergenic
1009209932 6:60849838-60849860 ATAAATACAAAAAAATAGCTGGG + Intergenic
1010069830 6:71731002-71731024 GTAAACAAAAAAATACAGGTAGG + Intergenic
1010251605 6:73713195-73713217 TTAAATTTACAAATACAGCTTGG - Intronic
1012234445 6:96797050-96797072 GAAAATACAAAAAAATAGCTGGG + Exonic
1013502522 6:110766837-110766859 GAAAATAAACAAATAAGGCTGGG + Intronic
1013762790 6:113537497-113537519 GTACATACATACATATAGCTGGG + Intergenic
1013911470 6:115280894-115280916 CCAAATAAACAAATACAGCCAGG - Intergenic
1016871446 6:148821128-148821150 GAAAATACACAAAATTAGCTGGG - Intronic
1017309955 6:152964335-152964357 ACAAATCCACAATTACAGCTAGG + Intergenic
1017513373 6:155133876-155133898 CTAAAAACACAAAATCAGCTGGG - Intronic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1018473776 6:164120816-164120838 GTAAATAAACAAATAAACCTGGG + Intergenic
1018673258 6:166197143-166197165 GTAATTACAGAAACACAGCAGGG - Intergenic
1019022304 6:168929576-168929598 GAAAACACACTAATACAGGTAGG + Intergenic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021728023 7:23568692-23568714 GAAAATACAAAAAAATAGCTGGG - Intergenic
1023694404 7:42829921-42829943 GCAAAAACACAAATCCAGGTGGG - Intergenic
1024383377 7:48724369-48724391 GAAAATAGACTAATACAGCCAGG - Intergenic
1025074108 7:55927605-55927627 GTAAAAAAATAGATACAGCTGGG + Intronic
1025934643 7:66025520-66025542 GAAAATACAAAAAAAAAGCTGGG + Intergenic
1026369114 7:69680963-69680985 TAAAATACTCAAATTCAGCTGGG - Intronic
1026378906 7:69779600-69779622 AAAAATACAAAAATATAGCTGGG + Intronic
1026990417 7:74582016-74582038 ATAAATAAATAAATAAAGCTTGG + Intronic
1026999849 7:74644877-74644899 GTAAAAACACAAAATCAGCCAGG + Intergenic
1028473393 7:91228475-91228497 AAAAATAAACAAATAAAGCTGGG - Intergenic
1028524337 7:91766945-91766967 GCAAATAAAAAAATTCAGCTGGG + Intronic
1028905638 7:96151434-96151456 CTAAATACACAAAATTAGCTGGG + Intronic
1029673751 7:102051698-102051720 GTAAATGCATAAATACCTCTGGG + Intronic
1030031584 7:105374768-105374790 CTAAAAACACAAAAATAGCTGGG - Intronic
1030803630 7:113886547-113886569 GAAAATAGACTAATACAGGTGGG + Intronic
1031372018 7:120979738-120979760 ATAAATACACAAATACTTCAAGG - Intergenic
1032135470 7:129273059-129273081 AAAAATACAAAAAAACAGCTGGG - Intronic
1032214492 7:129947072-129947094 ATACATACACAAATACAGGAGGG + Intronic
1033118088 7:138644038-138644060 CTAAAAACACAAAAATAGCTGGG + Intronic
1033920894 7:146390285-146390307 GTAAATACACAAATAGTACAAGG + Intronic
1034170499 7:149059305-149059327 CTAAAAAAAAAAATACAGCTGGG + Intergenic
1034722671 7:153309065-153309087 GTAGAAACCCATATACAGCTGGG - Intergenic
1035422149 7:158738746-158738768 TTAAATACACAAATATGGCTTGG - Intronic
1035883370 8:3266878-3266900 GTAGAAACACAAAACCAGCTGGG + Intronic
1035968341 8:4220108-4220130 GAAAATACAAAAAATCAGCTGGG - Intronic
1036947662 8:13109722-13109744 GAAAATACACAAAATTAGCTGGG + Intronic
1037074051 8:14690494-14690516 ATAAATACAGAAATACAGCAAGG + Intronic
1037242943 8:16798081-16798103 ATAAGTACACAAATACAGAATGG + Intergenic
1037782959 8:21883517-21883539 GAAAATACAAAAAATCAGCTAGG + Intergenic
1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG + Intergenic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038774190 8:30513245-30513267 ATAAAGAAACAAATTCAGCTGGG - Intronic
1038978784 8:32732966-32732988 CTAAATACAAAAAATCAGCTGGG - Intronic
1040032381 8:42837118-42837140 GCAGATACATAACTACAGCTGGG + Exonic
1041109622 8:54472261-54472283 CTAAAAACACAAAGTCAGCTGGG + Intergenic
1042238884 8:66642370-66642392 GTAAATACACAACCACAGAATGG - Intronic
1043249149 8:78048064-78048086 GTGAATACAAAAAGACAGTTAGG + Intergenic
1043999669 8:86864607-86864629 CTAAATATACAAAATCAGCTGGG + Intergenic
1044288793 8:90442900-90442922 GTACATACATAAATAAAACTGGG + Intergenic
1044673726 8:94709398-94709420 ATAAATAAATAAATAAAGCTGGG - Intergenic
1044954796 8:97468768-97468790 GTACATACACAGAGAAAGCTAGG - Intergenic
1045075691 8:98564515-98564537 ATAAATACAAAATTACAGTTAGG + Intronic
1045578554 8:103452830-103452852 GTAATTACAAATACACAGCTGGG + Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1046111901 8:109735587-109735609 CTAAAAACACAAATACAGTGTGG - Intergenic
1046262903 8:111793957-111793979 GTAAACAATAAAATACAGCTTGG + Intergenic
1047646475 8:126875426-126875448 CTAAAAATACAAAAACAGCTGGG + Intergenic
1048586007 8:135774752-135774774 GCAGATACAAAATTACAGCTAGG + Intergenic
1048643685 8:136393326-136393348 GTAAATAAACATAAAAAGCTTGG + Intergenic
1050335348 9:4584831-4584853 GTAAATAAACAAGTACACCATGG + Intronic
1050434056 9:5590745-5590767 CTAAATATACAAATTTAGCTGGG - Intergenic
1050894923 9:10874228-10874250 ATATATACACAAACACAGCTGGG + Intergenic
1051633037 9:19157651-19157673 CTAAATACACAAAATTAGCTGGG - Intergenic
1051897890 9:22007375-22007397 ATAAATAAATAAATAGAGCTTGG + Intronic
1052087689 9:24287926-24287948 ATAAATACAAAAATACACTTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052892946 9:33720436-33720458 GGAACTACACAATTACAGTTGGG - Intergenic
1052948442 9:34187914-34187936 ATAAATACATATATACATCTTGG + Intronic
1053085893 9:35221227-35221249 AAAAATACACAAAATCAGCTGGG - Intronic
1053099850 9:35362637-35362659 GTAAATACAAAAAATTAGCTGGG + Intronic
1053258084 9:36636339-36636361 GTAAAAATACAAAATCAGCTGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053675534 9:40421741-40421763 GAAAACAGACTAATACAGCTAGG + Intergenic
1053925328 9:43048079-43048101 GAAAACAGACTAATACAGCTAGG + Intergenic
1054288810 9:63260267-63260289 GAAAACAGACTAATACAGCTAGG + Intergenic
1054386632 9:64561804-64561826 GAAAACAGACTAATACAGCTAGG + Intergenic
1054509088 9:65954551-65954573 GAAAACAGACTAATACAGCTAGG - Intergenic
1055050098 9:71970912-71970934 AAAAATACACAAATTTAGCTGGG - Intronic
1055378142 9:75673389-75673411 ATAAATAAATAAATAAAGCTGGG - Intergenic
1056013395 9:82356092-82356114 ATCAATAAAAAAATACAGCTGGG - Intergenic
1056291262 9:85145932-85145954 AAAAATACAAAAAAACAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056849046 9:90065717-90065739 GAAAATACAAAAAAACAGCCTGG - Intergenic
1057455288 9:95203236-95203258 AAAAATACAAAAATATAGCTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057723313 9:97550079-97550101 GTAAATCCATAGATACAGATTGG - Intronic
1058428062 9:104893259-104893281 GAAAATACAAAAAAATAGCTGGG + Intronic
1058654829 9:107210737-107210759 GTAAAAACACAAAATTAGCTGGG - Intergenic
1059384808 9:113956046-113956068 CTAAATACAAAAAAATAGCTGGG + Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061148221 9:128812998-128813020 CTTAAAACACAAATACAGCTGGG - Intergenic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1185601198 X:1340688-1340710 GAAAACACACAAACACAGCCGGG + Intronic
1186156949 X:6735492-6735514 GTAAATACACAAAGAGAGAAAGG - Intergenic
1186722331 X:12318657-12318679 GTGGATACAAAAATACAGTTAGG + Intronic
1187025001 X:15425738-15425760 TTAAATTGACAAATACTGCTGGG - Intronic
1188016722 X:25114481-25114503 ATAAATAAACAAATGCAGCCGGG - Intergenic
1188307579 X:28577084-28577106 ATAAATACATAAATAAAACTAGG + Intergenic
1188327624 X:28824914-28824936 ATGAATACACAAATACAGAAAGG - Intronic
1188349385 X:29108748-29108770 GTAAATACAAACATACAATTCGG + Intronic
1188591286 X:31838839-31838861 GTTAATATTCAAACACAGCTAGG + Intronic
1188718459 X:33492885-33492907 ATAAATACATACATACAGTTGGG - Intergenic
1189060712 X:37750153-37750175 ATAAATAAACAAACACTGCTGGG + Intronic
1189115064 X:38333696-38333718 AGAAAGAAACAAATACAGCTAGG - Intronic
1189248255 X:39580116-39580138 GTAAAAAGACGAATACAGCCAGG - Intergenic
1189977744 X:46479266-46479288 AAAAATACACAAAATCAGCTGGG + Intronic
1190483925 X:50905323-50905345 ATAAATAAATAAATACAGATAGG + Intergenic
1190533298 X:51402492-51402514 AAAAATACACAAATTTAGCTGGG + Intergenic
1191840027 X:65506327-65506349 ATGAATACATAAATACAGCATGG + Exonic
1192522097 X:71811579-71811601 GTTAATACACAAATTCAACGAGG - Intergenic
1192737902 X:73865972-73865994 GTAAATATCCAAATACAGGAAGG + Intergenic
1192882969 X:75307182-75307204 ATAAAAACACAAATAGGGCTGGG - Intergenic
1193189799 X:78556568-78556590 ATAAATACAAAAATAAAGCCTGG - Intergenic
1193370208 X:80687085-80687107 ATATATACACACATACAGATAGG - Intronic
1194285178 X:92001627-92001649 CTAAAAACACAAATTTAGCTAGG - Intronic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1194972267 X:100357153-100357175 GTAAATACACATACACAGACTGG + Intronic
1195252436 X:103062345-103062367 GTAAATATACATATACATCATGG - Intergenic
1195416460 X:104625362-104625384 GTACATAAAAAAATACAGCTTGG + Intronic
1196194995 X:112830189-112830211 GTAAAAACCCAAATACACATAGG - Intronic
1196747518 X:119085039-119085061 AAAAATACAAAAACACAGCTGGG - Intronic
1197855970 X:130914462-130914484 GTAAAATCACAAATACTCCTGGG + Intergenic
1197885825 X:131217431-131217453 ATGAAGACACAAATACAGCGTGG - Intergenic
1198278217 X:135117458-135117480 GTATATACCCAAGTACTGCTTGG + Intergenic
1198292745 X:135255058-135255080 GTATATACCCAAGTACTGCTTGG - Intronic
1198539115 X:137618207-137618229 AAAAATACAAAAAAACAGCTGGG - Intergenic
1199018177 X:142844484-142844506 GTATATACACATATACACATAGG + Intergenic
1199268071 X:145850352-145850374 ATAATTTCACAAAAACAGCTTGG - Intergenic
1199368530 X:147017942-147017964 CTAAAAACACAAAAATAGCTGGG - Intergenic
1200602746 Y:5226170-5226192 CTAAAAACACAAATTTAGCTAGG - Intronic
1200657344 Y:5919286-5919308 ATGAATACAAAAATACAGTTAGG + Intergenic
1201012891 Y:9566349-9566371 GTACACACACAAAAAAAGCTAGG + Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic