ID: 1061172746

View in Genome Browser
Species Human (GRCh38)
Location 9:128970320-128970342
Sequence TCATTCATGGAGATGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061172743_1061172746 8 Left 1061172743 9:128970289-128970311 CCAAGGTGATAATTGAGTCTGTG 0: 1
1: 0
2: 0
3: 6
4: 135
Right 1061172746 9:128970320-128970342 TCATTCATGGAGATGGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061172746 Original CRISPR TCATTCATGGAGATGGTACA AGG Intronic
No off target data available for this crispr