ID: 1061175663

View in Genome Browser
Species Human (GRCh38)
Location 9:128994978-128995000
Sequence GTGGCCTACCACTGGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061175649_1061175663 20 Left 1061175649 9:128994935-128994957 CCCCTCTTGAGATTTTAACTGAA 0: 1
1: 0
2: 0
3: 28
4: 495
Right 1061175663 9:128994978-128995000 GTGGCCTACCACTGGGTGCATGG 0: 1
1: 0
2: 1
3: 16
4: 166
1061175651_1061175663 18 Left 1061175651 9:128994937-128994959 CCTCTTGAGATTTTAACTGAAGG 0: 1
1: 0
2: 2
3: 31
4: 160
Right 1061175663 9:128994978-128995000 GTGGCCTACCACTGGGTGCATGG 0: 1
1: 0
2: 1
3: 16
4: 166
1061175650_1061175663 19 Left 1061175650 9:128994936-128994958 CCCTCTTGAGATTTTAACTGAAG 0: 1
1: 0
2: 3
3: 58
4: 263
Right 1061175663 9:128994978-128995000 GTGGCCTACCACTGGGTGCATGG 0: 1
1: 0
2: 1
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061175663 Original CRISPR GTGGCCTACCACTGGGTGCA TGG Intronic
904309505 1:29619190-29619212 GTGGCCTACCTGAGGGTGGAAGG + Intergenic
905798818 1:40830639-40830661 GAGGCCTACCTCCGTGTGCATGG + Intronic
906154294 1:43605127-43605149 GTTCCCTACCACGGGCTGCAAGG - Intronic
906239872 1:44236184-44236206 CTGGCCCACCCCTGGGTGCCAGG - Intronic
909252552 1:73377055-73377077 ATGGCATTCCACTGGATGCAGGG + Intergenic
911086024 1:93978205-93978227 GTGGGCTACCACTGGGAGTGAGG + Intergenic
911571537 1:99523362-99523384 GGGGCCTGCCACAGGGTGGAGGG - Intergenic
912611218 1:111046680-111046702 GTGGCCTACCTGAGGGTGGAGGG - Intergenic
913499251 1:119455767-119455789 AAGGCCTAACACTGGGAGCATGG - Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
916647112 1:166797155-166797177 GTGGCCTCCTCCTGGGAGCAGGG - Intergenic
917524898 1:175779882-175779904 GTGGCCTACCAGAGGCTGGAGGG + Intergenic
920607008 1:207398835-207398857 CTGACCTCCCACTGGGTACAAGG - Intergenic
920935031 1:210424596-210424618 GGGGCCTATCACGGGGTGGAGGG - Intronic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
924435657 1:244038745-244038767 ATGGCCTTCCACAGGCTGCAGGG - Intergenic
1063343367 10:5289597-5289619 GGGGCCTATCAGTGGGTGGAGGG + Intergenic
1067017604 10:42769754-42769776 ATGGCCTTCCACTGGGGGCGTGG + Intergenic
1067049018 10:43001386-43001408 GCAGCCTACCAGGGGGTGCAGGG - Intergenic
1067274534 10:44822002-44822024 GTGTCCTGCCTCTGAGTGCAGGG - Intergenic
1068564832 10:58563079-58563101 TTGCCGTACCACTGGGTTCAGGG + Intronic
1072044461 10:91640761-91640783 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1073539025 10:104303107-104303129 GAGGCCTATCAGAGGGTGCAGGG - Intronic
1073559045 10:104481488-104481510 GTGGGCTTCCTCTGGCTGCAGGG + Intergenic
1076844855 10:133065066-133065088 GTGGCATTCCGCTGTGTGCAGGG + Intergenic
1082998228 11:59269319-59269341 GTCCCCTTCCAGTGGGTGCACGG - Intergenic
1085250001 11:75136824-75136846 CTGGCTTTGCACTGGGTGCATGG + Intronic
1085530417 11:77189255-77189277 GTGGCGTCCCACTGGCTGCTAGG + Intronic
1088270758 11:108032008-108032030 GGGGCCTACCAGAGGGTGAAGGG + Intronic
1089184923 11:116608366-116608388 GTGCCCTAGCACTGGGAGTAAGG + Intergenic
1090143291 11:124289768-124289790 GGGGCCTACTACAGGGTGCAGGG - Intergenic
1091583106 12:1800538-1800560 CTGCCCTGCCACTGGGAGCAGGG + Intronic
1091776449 12:3187998-3188020 GTGGCGTACCTATGGGTGCTGGG + Intronic
1092042001 12:5393407-5393429 GTCTCTTACCACTGGGTGCAGGG + Intergenic
1093691140 12:22110530-22110552 TTGGCCAACCATTTGGTGCAAGG + Intronic
1098145677 12:67495630-67495652 GGGGCCTACCAGGGGGTGAAGGG + Intergenic
1098347326 12:69519559-69519581 GTGGCCTACCAGAGGGTGGAGGG - Intronic
1098798868 12:74927293-74927315 GGGGCCTACAAGGGGGTGCAGGG + Intergenic
1100002038 12:89848943-89848965 GTGCCCTACCTCTGGCTGCAAGG - Intergenic
1100696202 12:97096792-97096814 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1101733020 12:107442157-107442179 GGGGCCTAGCACAGGGTGCATGG + Intronic
1103590762 12:121990445-121990467 GTGGTCTAGAATTGGGTGCATGG + Intronic
1104016599 12:124965925-124965947 GTGGCCTGCCCCGGGTTGCATGG - Intronic
1104149331 12:126067253-126067275 GTTGCCAATCACTGGGTGCTGGG - Intergenic
1104341505 12:127954144-127954166 GGGTCCTACCAGAGGGTGCAGGG - Intergenic
1107008433 13:35642060-35642082 GTTGTCTACCAATGGCTGCATGG + Intronic
1107245975 13:38294322-38294344 GTGCTCTAACAGTGGGTGCAGGG - Intergenic
1108006570 13:45953278-45953300 ATGGCTCACCACTGGGTGGAGGG - Intergenic
1114279339 14:21176806-21176828 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1115485615 14:33908728-33908750 GAAGCCTCCCACTGGGTGCCAGG + Intergenic
1116280002 14:42894505-42894527 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1119788706 14:77330689-77330711 GTGCCCTACCAAAGGGTTCACGG - Intronic
1123814014 15:23958104-23958126 GGGGCCTACCTCAGGGTGGAAGG - Intergenic
1124095371 15:26644069-26644091 GGGGCCTACCAGCGGTTGCAGGG + Intronic
1129491321 15:75928571-75928593 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1129712078 15:77825568-77825590 TTGGCCTTCCTCTGTGTGCATGG - Intergenic
1132869360 16:2108877-2108899 GTGGCCTACCACTGGGACTTTGG - Exonic
1132935251 16:2476748-2476770 GTGGCTTTCCACTGGGTTGAGGG + Intronic
1133205394 16:4230288-4230310 ATGGTCTTCCACTGGGTGGAGGG - Intronic
1134625715 16:15721153-15721175 TTGGCCTCCCACAGGATGCATGG + Intronic
1134718052 16:16366721-16366743 GTGGCCTACCACTGGGACTTTGG + Intergenic
1134956700 16:18385438-18385460 GTGGCCTACCACTGGGACTTTGG - Intergenic
1136178611 16:28535793-28535815 GTAGCCTCCAACTGGGTTCAAGG + Intronic
1137653037 16:50136639-50136661 GTGGCCTACCAGTGGGAGTAGGG - Intergenic
1137680906 16:50343819-50343841 GGAGCCTACCTCTGGGGGCAGGG + Intronic
1139618473 16:68116300-68116322 GTGGCCTACCACTTGTTGGTGGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140572224 16:76120927-76120949 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1140862715 16:79032921-79032943 GGGGCCTACCAAAGGGTGGAGGG - Intronic
1143015907 17:3891085-3891107 GTGGCCTCAGACTGGGGGCAAGG + Intronic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1151825783 17:76523474-76523496 GTGGGCTATGCCTGGGTGCAGGG - Intergenic
1152474781 17:80510843-80510865 GTGGCCAAGCCCTGGGTGCAGGG + Intergenic
1152635200 17:81428059-81428081 GTGGCCTCTTCCTGGGTGCAGGG + Intronic
1153326548 18:3826578-3826600 CTGGCCTCCCGCTGTGTGCATGG - Intronic
1157568521 18:48696884-48696906 GTGGCCATTCACTGGCTGCATGG - Intronic
1158294877 18:55984785-55984807 GGGGCCTACCAGAGGGTGGATGG + Intergenic
1158950837 18:62493221-62493243 GTGCCCACCCACTGGGTGCATGG + Intergenic
1159564793 18:70036532-70036554 GGGGCCTACCAGTGGGTGAAGGG + Intronic
1159932646 18:74330048-74330070 GTGCCCTACCTCTGGGTGAATGG + Intronic
1160081747 18:75734411-75734433 GGGGCCTACCAGAGGGTGCAGGG - Intergenic
1164483297 19:28632840-28632862 GTGGCCTTTCACTGGGGGAAGGG - Intergenic
1165031263 19:32999553-32999575 GGGGCCCACATCTGGGTGCAGGG + Intronic
1166562831 19:43744716-43744738 GTGGGCACCCACTGGGAGCAGGG - Intronic
1167619808 19:50554444-50554466 GTAGCTTTCCTCTGGGTGCACGG - Intronic
1167842559 19:52133877-52133899 GGGGCCTACCTCAGGGTGGAGGG - Intronic
925005133 2:437324-437346 GTGAGCTCCCACTGTGTGCATGG + Intergenic
925005140 2:437397-437419 GTGAGCTCCCACTGTGTGCATGG + Intergenic
925005145 2:437447-437469 GTGAGCTCCCACTGTGTGCATGG + Intergenic
925005148 2:437472-437494 GTGAGCTCCCACTGTGTGCATGG + Intergenic
925517814 2:4704257-4704279 GTGGCATATCTCTGGGTGAAAGG - Intergenic
926906348 2:17809161-17809183 GTGGCCTTCCACTGAGTGCCTGG + Intergenic
927845691 2:26471211-26471233 GTGGCCTAGCACAGGGTGTGTGG + Intronic
927888409 2:26732555-26732577 GTGTCCTGCCTCTGGGGGCAGGG - Exonic
928116799 2:28550956-28550978 GTGGCCATCCCCTGGGTGCCTGG + Intronic
932748424 2:74354727-74354749 ATGGACTAGTACTGGGTGCATGG - Intronic
933158565 2:79000117-79000139 ATGGGCTACAACTGGGTGCCAGG + Intergenic
934143367 2:89069804-89069826 GTGGCCATCCACTGGCTGAATGG + Intergenic
934225873 2:90130751-90130773 GTGGCCATCCACTGGCTGAATGG - Intergenic
942253717 2:174070644-174070666 GTGGCCTTCATCTGGCTGCAAGG + Intergenic
942858612 2:180582723-180582745 TTGACCTCCCACTGGGTGCCAGG + Intergenic
943776223 2:191769305-191769327 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
943963405 2:194297990-194298012 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1173463409 20:43262094-43262116 GGGGCCTGCCAATGGCTGCAAGG - Intergenic
1174279696 20:49430210-49430232 GTTGCCTGCCATTGGGTTCAAGG + Intronic
1174793150 20:53498731-53498753 GGGACCTGGCACTGGGTGCAGGG - Intergenic
1176171231 20:63697268-63697290 GTGTCCTAGCTCAGGGTGCAAGG - Intronic
1177575017 21:22942756-22942778 GGGGCCTACCAGAGGGTGAAAGG - Intergenic
1181399765 22:22644276-22644298 ATGGCCTGCCACTCAGTGCACGG + Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1183686359 22:39363404-39363426 GTGGCCTGCCCCAGGGTGGAGGG + Intronic
1184451343 22:44584502-44584524 GTGGGCTGCCACTTGGTGCCAGG - Intergenic
949901025 3:8814878-8814900 TTAGTCTACCACTGGGGGCAAGG - Intronic
953964456 3:47292581-47292603 AGGGTCTACCACTGGGTGAATGG + Intronic
954073398 3:48159288-48159310 TTAGTCTACCACTGGGGGCAGGG + Intronic
957250183 3:77762520-77762542 GAGGCCTGTCACTGGGTGCGGGG + Intergenic
957536189 3:81506904-81506926 GGGGCCTACCAGAGGGTGGAGGG + Intronic
961602439 3:128072208-128072230 GTGGCCTACCACTGGGGGCTTGG - Intronic
961909186 3:130296901-130296923 GAGGCCTGCCATGGGGTGCAGGG + Intergenic
962121944 3:132570663-132570685 GTAGCCTACCAGAGGGTGGAAGG - Intronic
964852021 3:161105171-161105193 GAGTCCTGCCACTGGGTGGAGGG - Intronic
968780858 4:2580316-2580338 GTGGCCTATCAAAGGGTGGAGGG + Intronic
968845776 4:3040935-3040957 CTGGCCTCTCCCTGGGTGCAGGG - Intergenic
969725323 4:8915066-8915088 CTTGCCTACCCCTGGATGCATGG - Intergenic
973160683 4:47012350-47012372 GTGGCCTATCAGAGGGTGGAGGG - Intronic
978336933 4:107679207-107679229 GTGGCTTATCACTTGGTGCTAGG - Intronic
979737382 4:124104454-124104476 TTGGCATACCTCTGGGTGCCTGG - Intergenic
980652352 4:135734706-135734728 GTGGCAGACCACTGGGCCCATGG - Intergenic
984508693 4:180653345-180653367 GGGGCCTATCAGTGGGTGGAGGG + Intergenic
985202556 4:187498720-187498742 GTGGCCAAGACCTGGGTGCAGGG - Intergenic
987400951 5:17476146-17476168 GGGGCCTACCTGTGGGTGGAGGG + Intergenic
990797056 5:59555332-59555354 GGGGCCTACCAGAGGGTGGAGGG + Intronic
991419516 5:66426870-66426892 GTGGCCCACCACTGGGGGCTTGG - Intergenic
996288381 5:121822824-121822846 GTGGACTACCAGAGGGTGGAGGG - Intergenic
999527895 5:152428029-152428051 CTGTCTTGCCACTGGGTGCAGGG - Intronic
1000443676 5:161294055-161294077 ATGGCCTCCCACTGGAAGCAAGG - Exonic
1001860230 5:175047881-175047903 CTGCCCTACCACTGGCTGCCGGG + Intergenic
1001999564 5:176190073-176190095 CTGGCCATCCAGTGGGTGCACGG - Intergenic
1005574496 6:27178987-27179009 GAGACATACCACTGGGCGCAAGG + Intergenic
1007513219 6:42390818-42390840 GTGGCTTACAGCTGGGGGCAAGG + Intronic
1013620826 6:111887166-111887188 GGGGCCTACCAGAGGGTGAAGGG + Intergenic
1013848517 6:114484766-114484788 GGGGCCTACCAGAGGGTGGAGGG + Intergenic
1017945601 6:159094291-159094313 GTGGCTTCCCACTGGGCACAGGG - Intergenic
1019051605 6:169188046-169188068 GTGGCCTTCTACTGGGGACAGGG - Intergenic
1022743324 7:33144127-33144149 GTAACCTTCCACTGGTTGCATGG + Intronic
1028444922 7:90910935-90910957 GTGGCCTACCAGAGGGTGGAGGG - Intronic
1029703401 7:102262481-102262503 CTGCCCTGCCACTGGGTGCTGGG - Intronic
1029857829 7:103536541-103536563 GTGGTCTCACACTGGCTGCACGG - Intronic
1034492277 7:151399814-151399836 GTGGCTCCCCGCTGGGTGCAGGG - Intronic
1034931669 7:155168212-155168234 GTGGGCTTCCAGTGGCTGCAAGG - Intergenic
1035069064 7:156127662-156127684 GTTGGCTACCCCAGGGTGCACGG - Intergenic
1037982076 8:23261532-23261554 GTGGCCTACTGCTCGGGGCAGGG + Exonic
1039839151 8:41281158-41281180 ATGGCCTTCCACTCCGTGCAGGG + Intronic
1040462521 8:47662512-47662534 GTGGACTCCCACTGGGTCTAAGG + Intronic
1041116808 8:54547949-54547971 GTGGCCTATCAGAGGGTGGAGGG + Intergenic
1043418594 8:80076492-80076514 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1045189919 8:99872156-99872178 GAGGCCTGCAACTGGCTGCAGGG + Intronic
1049128622 8:140815402-140815424 GGGGCCTACCAGAGGGTGGAGGG + Intronic
1049912692 9:284930-284952 GTGGCCTACTTGTGGGTGAAGGG + Intronic
1055414575 9:76067086-76067108 GTGGCCTAAAACTGTGTGCTGGG - Intronic
1057980352 9:99654890-99654912 GGGGCCTACTAGAGGGTGCAGGG + Intergenic
1060337086 9:122735300-122735322 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1060816277 9:126637036-126637058 GTGGCCTCTGGCTGGGTGCAAGG - Intronic
1060977194 9:127771568-127771590 GTGGCCTACCCCAGGCTGCGCGG - Intronic
1061034851 9:128107786-128107808 GTGGCCAACAGCTGGCTGCAAGG - Exonic
1061175663 9:128994978-128995000 GTGGCCTACCACTGGGTGCATGG + Intronic
1061190681 9:129081027-129081049 TTGGCCTCCGATTGGGTGCACGG + Intergenic
1061246960 9:129405453-129405475 GGGGCCTCCCACTGTGAGCAGGG + Intergenic
1187107348 X:16257542-16257564 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1187464740 X:19516759-19516781 GTGGCCTATCAGAGGGTGAAGGG - Intergenic
1189923976 X:45933746-45933768 GTGAGCTCCCACTGTGTGCAAGG + Intergenic
1190874281 X:54448861-54448883 GTGGCCTTGCACGGGGTGCCTGG - Exonic
1190902739 X:54694480-54694502 GGGGCCTACCAGAGGGTGGAGGG + Intergenic
1191033921 X:56005392-56005414 GTGGCATACCAGTGAGAGCAAGG + Intergenic
1193638739 X:83985212-83985234 GTGGGCCGCCAGTGGGTGCAGGG - Intergenic
1194525494 X:94972126-94972148 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1194942787 X:100032445-100032467 GGGGCCTACCACAGGGTGGAGGG + Intergenic
1195568821 X:106376766-106376788 GAGGCCTACCAGAGGGTGAATGG + Intergenic
1196338201 X:114564217-114564239 GGGGCCTATCACAGGGTGGAGGG + Intergenic
1196754986 X:119150291-119150313 ATTCCCTACCACTTGGTGCAGGG - Exonic
1197626779 X:128810832-128810854 GGGGCCTACCAGAGGGTGGAGGG - Intergenic
1198494856 X:137181897-137181919 TTGGCCTATAACTGGGAGCAAGG + Intergenic
1198728926 X:139706549-139706571 GTGGACTACTAGAGGGTGCAGGG + Intronic
1200761100 Y:7039863-7039885 TTGCTCTACCACTGGGTGCCTGG - Intronic