ID: 1061176185

View in Genome Browser
Species Human (GRCh38)
Location 9:128998782-128998804
Sequence GGATATCCTGAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061176176_1061176185 30 Left 1061176176 9:128998729-128998751 CCATCTTGAGGAATGGGAGTGAC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG 0: 1
1: 0
2: 2
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061176185 Original CRISPR GGATATCCTGAGATGGAGCA GGG Intronic
902915916 1:19639334-19639356 GATTATAATGAGATGGAGCAAGG - Intronic
908716425 1:67075152-67075174 GGATATCCTGAATTGGATCCTGG + Intergenic
910015684 1:82520414-82520436 GGATATACTGAGAGGCAGGATGG + Intergenic
913099280 1:115548121-115548143 GGAGATGCTGTGATGAAGCAAGG + Intergenic
914504702 1:148278866-148278888 GGAGTCCCTGAGAAGGAGCAGGG + Intergenic
914507937 1:148305531-148305553 GGAGTCCCTGAGAAGGAGCAGGG - Intergenic
914920781 1:151846100-151846122 GGATATTGTGATATGGAGCTTGG - Intergenic
920664945 1:207956454-207956476 GGAACTCCTGAGATGGATGAGGG + Intergenic
920916191 1:210259932-210259954 GGAGCTCCAGAGATGGGGCAGGG + Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
923108899 1:230875489-230875511 GGATATGATGAGGTGGTGCAGGG - Intergenic
1062832289 10:613942-613964 GAATATCCTGGGCTGGAGGAAGG - Intronic
1064099548 10:12451485-12451507 GGAAATCCTCAAATGGAGCCAGG - Intronic
1065506277 10:26433157-26433179 TGATATCCAGAGATGTTGCAAGG - Intergenic
1065654368 10:27932599-27932621 GGAGAACCTGAGATGGAACTGGG - Intronic
1065945326 10:30600901-30600923 TGATTTGGTGAGATGGAGCAGGG - Intergenic
1067563371 10:47319744-47319766 GGATTTTCTCAGATGGACCAGGG + Intergenic
1070094033 10:73318952-73318974 TGTTTTACTGAGATGGAGCAAGG + Intronic
1074712111 10:116185928-116185950 GGATATCCAGACATGGAGTCTGG + Intronic
1078116544 11:8458017-8458039 GGATATCATGATAAGGAGTATGG + Intronic
1078637249 11:13063413-13063435 GCATTTCCTGAGATGGGGAATGG - Intergenic
1083714272 11:64566960-64566982 GCAGACCCTGAGATGGAGAAGGG + Intronic
1084603647 11:70160676-70160698 GGACATCCTCAGGTGGTGCAGGG - Intronic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1087999569 11:104859805-104859827 GGATATCCTGACATGAAGGAGGG - Intergenic
1088998957 11:115032825-115032847 GCTTATTTTGAGATGGAGCATGG - Intergenic
1089914791 11:122143093-122143115 GGATATTGTGACATTGAGCAAGG - Intergenic
1090920109 11:131199339-131199361 AGATCTCCTGAGGTGGAGCAAGG + Intergenic
1091911240 12:4232272-4232294 GGGAATCATGAGATTGAGCAGGG + Intergenic
1092461679 12:8692703-8692725 TAATGTGCTGAGATGGAGCAGGG + Intronic
1094194864 12:27738311-27738333 TGATCTCATGTGATGGAGCACGG - Intronic
1098035100 12:66293566-66293588 GTACATCCTAAGAAGGAGCAAGG - Intergenic
1101698478 12:107149456-107149478 GTAAATGCTGAGATGGAGAAGGG - Intergenic
1105590785 13:21791080-21791102 GGATGTCCAAAGATGGGGCATGG - Intergenic
1107709091 13:43134814-43134836 TCCCATCCTGAGATGGAGCAGGG - Intergenic
1107886265 13:44876615-44876637 GGAGATCCTGATATGATGCAGGG - Intergenic
1108485346 13:50917946-50917968 AAACATACTGAGATGGAGCATGG - Intronic
1109710352 13:66151137-66151159 GGATAGCATGTGATGCAGCAAGG + Intergenic
1113305736 13:109076593-109076615 GGATTTCTTGAGATGGAGCATGG - Intronic
1114065753 14:19058871-19058893 GGAGATCTTGATTTGGAGCAGGG - Intergenic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1118777805 14:68984487-68984509 GGAGGTCCTGAGATGGACCAAGG + Intergenic
1119187580 14:72653721-72653743 GGATATCCTGAGATGCTGGCTGG - Intronic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120633120 14:86915746-86915768 GGAAATCCTGAGATTGGGCTTGG - Intronic
1121724297 14:96135322-96135344 AGATATCCTGAGATGGAAATGGG - Intergenic
1122195671 14:100083166-100083188 AGAGATCCTGAGATGCAGCATGG - Intronic
1123818870 15:24006194-24006216 GAAGATCCTGTGATAGAGCAGGG - Intergenic
1123832414 15:24154406-24154428 TAAGATCCTGTGATGGAGCAGGG + Intergenic
1123837946 15:24214870-24214892 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123866527 15:24524547-24524569 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123922153 15:25077794-25077816 GGTCATCATGAAATGGAGCATGG - Intergenic
1128934034 15:71730350-71730372 GGATTTCCTGATGGGGAGCAGGG - Intronic
1130152252 15:81320027-81320049 GGATATGCTGAGATTGAGTGAGG - Intronic
1130541948 15:84826790-84826812 TGGTATCCAGGGATGGAGCAGGG + Intronic
1132737773 16:1395577-1395599 GGGCAGCCTGAGATGGAGCCAGG - Intronic
1133203780 16:4220607-4220629 GGATATCCAGAGAGGGAGCCAGG - Intronic
1133597375 16:7305453-7305475 GGAGATCCTGGGAGGGAGAAAGG - Intronic
1133741958 16:8658609-8658631 GGATATCCTGAGATGCTGTGAGG + Intergenic
1136317511 16:29463096-29463118 TCATATCCTGATCTGGAGCAAGG - Intronic
1136432086 16:30202441-30202463 TCATATCCTGATCTGGAGCAAGG - Intronic
1137037233 16:35577308-35577330 GGACCTCCTGAGGTGGAGCAGGG - Intergenic
1137319959 16:47370495-47370517 GGACAACCAGAGATTGAGCAAGG - Intronic
1137514099 16:49127590-49127612 GGATAGTGTGAGATGGGGCAGGG + Intergenic
1139662291 16:68429431-68429453 GGATTTCCTGAGAAGGATCTGGG + Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1143596061 17:7914958-7914980 GGAGATTCTGAAATGAAGCAAGG + Intergenic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1146453393 17:32991883-32991905 GGACATCTTGAGCTGAAGCAGGG + Exonic
1146641465 17:34544762-34544784 GGAAATCCTCAGATGGAAAAAGG + Intergenic
1148080541 17:44965723-44965745 GGACTTCCTGAGGTGGTGCAGGG + Intronic
1150840619 17:68602141-68602163 GGATTTCCTGAAATTCAGCAGGG - Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1153961874 18:10147126-10147148 GCAGATGCTGAGATGGAGCTTGG + Intergenic
1154216816 18:12421415-12421437 TGATATCATGGGATGCAGCAAGG - Intronic
1158123054 18:54071365-54071387 GGATATCAGGAGATAGAGCTTGG - Intergenic
1161954127 19:7483376-7483398 GGATTTCCTGAGAAGCGGCAGGG + Intronic
1162081153 19:8218614-8218636 GGAGATCTTGAGATGGGGAAGGG + Intronic
1163748613 19:19062477-19062499 GGGAATCCTGGGAGGGAGCAAGG - Intergenic
1164176990 19:22783975-22783997 CGATATCCTGAGAAGGGGAAGGG - Intronic
1164562741 19:29304049-29304071 GGAAATCCAGAGGTGGAGGAAGG + Intergenic
1165891878 19:39117538-39117560 GGCCATCCTAAGATTGAGCAAGG + Intergenic
925011739 2:490602-490624 GGATATGCTGAGAGAGAGGAAGG + Intergenic
925616228 2:5746912-5746934 GGATATACTCAGATGAAGAAGGG - Intergenic
926707270 2:15845700-15845722 GGAGAAACTGAGATGGAGAAGGG - Intergenic
930406303 2:50960623-50960645 GTAAATCCTGAGAGGAAGCAAGG - Intronic
932734742 2:74246792-74246814 GGATATCCTAGGAAGGAGTAAGG - Intronic
933073480 2:77891997-77892019 AGGGAACCTGAGATGGAGCAGGG - Intergenic
935620677 2:105127006-105127028 GCAGATGCTGAGATGGAGCTTGG + Intergenic
936886633 2:117318522-117318544 GGATATCTTGGGATGGGGGAGGG + Intergenic
947758067 2:232583105-232583127 TGATATGCTGAGATGTGGCACGG + Intronic
1173921996 20:46753162-46753184 GGCTATCGTGAGATTAAGCAGGG + Intergenic
1175649475 20:60706038-60706060 GGGAATTCTGAGATGGAACATGG - Intergenic
1177112186 21:17042004-17042026 GGATTACCTGACATGCAGCATGG + Intergenic
1178309404 21:31517201-31517223 TGAGATCGTGTGATGGAGCAGGG - Intronic
1178486354 21:33022108-33022130 TGAGAACCTGAGATGGAGAAAGG + Intergenic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1178884709 21:36476093-36476115 GGATCTCCTGAGATGGAGACAGG + Intronic
1179010567 21:37552975-37552997 GGATCTCCTGACATGGTCCAGGG + Intergenic
1179925483 21:44531836-44531858 TGAACTCCGGAGATGGAGCAAGG + Intronic
1182146585 22:28000523-28000545 GGACATCCGGAGTTGGAGGATGG + Intronic
1182599748 22:31451825-31451847 GGATGTCCTGAAATGCAGGAGGG - Intronic
1183272352 22:36870051-36870073 GGATGTCATGAGATGGAGCAAGG + Intronic
1184554786 22:45227262-45227284 GGAGAGCATGAGATCGAGCAGGG - Intronic
1185231727 22:49687637-49687659 AGACATCCTGAGATGGAGGGAGG - Intergenic
949942382 3:9164955-9164977 GGAGACCCAGAGACGGAGCAGGG - Intronic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
951545288 3:23818801-23818823 GGATGTCTTCAGATGGAGGATGG + Intronic
953245132 3:41184124-41184146 GCATATCCTGAGATGCATTAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953461984 3:43088815-43088837 GGATGTCCAGAGATGGGGCTTGG - Intronic
953578691 3:44134209-44134231 GGAAATCAAGAGATGGAGGAAGG - Intergenic
953836937 3:46354550-46354572 GGATCTCCTGAGTTGAGGCAAGG - Intronic
956444429 3:69312140-69312162 GGATCTGCTGAGAAGAAGCATGG + Intronic
959327677 3:104957373-104957395 GGACAACCTGAGAGTGAGCAAGG + Intergenic
961167618 3:124774368-124774390 GGTTCTTCTGAGAGGGAGCAAGG + Intronic
961753812 3:129114735-129114757 GGATATCCTGAGTCACAGCATGG + Intronic
961902229 3:130224251-130224273 GGATCTCTTGAAATGGGGCAAGG - Intergenic
972340651 4:38149648-38149670 AGATGCCCTGAGAGGGAGCATGG - Intergenic
974011660 4:56612996-56613018 GGCTGTGATGAGATGGAGCAGGG - Intergenic
975512657 4:75210892-75210914 GGAGAACCTGAGAGGGAGCCAGG - Intergenic
978983329 4:114979310-114979332 GGAAAACATGAGATAGAGCATGG - Intronic
980427356 4:132643790-132643812 GGTTGCCCTGAGAAGGAGCATGG - Intergenic
981269979 4:142834503-142834525 GGTCATCCTAAAATGGAGCATGG + Intronic
982241553 4:153304754-153304776 GAATCTCTTGAGATGGACCAAGG + Intronic
986438612 5:7759240-7759262 GGAGCTCCTGAAATGGAGCTGGG - Intronic
987372849 5:17208936-17208958 GGAAATCCTGACACGGACCAAGG + Intronic
990475857 5:56161114-56161136 GGCAATTCTGAGATGGAGCCAGG - Intronic
992774417 5:80077124-80077146 GGATATTCTGAGTTGGTGCCTGG - Intronic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
993795791 5:92266418-92266440 GGATATGCTGAGATTGGACATGG - Intergenic
994944474 5:106368303-106368325 GGACAGCCTGAGATGTAGGAGGG + Intergenic
995763965 5:115595785-115595807 GTACATTCTAAGATGGAGCATGG - Intronic
996236397 5:121135910-121135932 CTAGATTCTGAGATGGAGCAGGG - Intergenic
997570326 5:134922393-134922415 GGATAGTGTGAGATGGGGCATGG - Intronic
998135671 5:139673204-139673226 GGATAACATGAGATAAAGCATGG + Intronic
998293443 5:140940803-140940825 GGATATCCTGAGATCTTGGATGG + Intronic
999592575 5:153164647-153164669 GGATAGCCTGACATTTAGCATGG + Intergenic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1005525129 6:26639946-26639968 GGCTATCCTTAGATTGAGCAAGG - Intronic
1012584232 6:100903408-100903430 GGATGTCATGATATGGAGAAAGG - Intergenic
1013176293 6:107680112-107680134 GCAGATCCTGAGCTGGAGCAAGG + Intergenic
1018149110 6:160921922-160921944 GGATATCCTGATGTAGAGGAGGG + Intergenic
1018310418 6:162502463-162502485 GTACCTCCTGAGATGAAGCAAGG + Intronic
1019264431 7:105386-105408 GGATAGCTTGGGCTGGAGCAAGG + Intergenic
1020220419 7:6232412-6232434 CGATAGCCTTAGAAGGAGCAGGG - Intronic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1028288098 7:89029430-89029452 GAATATCCTGAGATGTAATATGG + Intronic
1030490741 7:110230990-110231012 AGATATCCTGAAATGAAGCAAGG - Intergenic
1030971608 7:116064061-116064083 GGGTTTCCTGGGATGGAGCGGGG + Intronic
1035082275 7:156226696-156226718 GGAGATCCTGAGTTGTGGCATGG - Intergenic
1036638190 8:10565530-10565552 GGATTTTCTGAGCTGGAGCCAGG - Intergenic
1037569855 8:20149020-20149042 GGAGGTCCTGAGCAGGAGCATGG - Intronic
1038056661 8:23864970-23864992 GACTATCCTGAGATGCAGTATGG + Intergenic
1038248901 8:25884337-25884359 GGAGCTCCTGCGATGGAGGAGGG + Intronic
1038475312 8:27862170-27862192 GGGTATCCTGAGGGGGTGCAGGG + Intergenic
1038534893 8:28346882-28346904 GGCTAGCCTGAGGTGGCGCAGGG - Exonic
1039416631 8:37400537-37400559 GGAGAGCCTGAGATAGAGCTGGG - Intergenic
1041106685 8:54451731-54451753 GGATAGACAGAGATGGAGTAAGG - Intergenic
1041158113 8:55008895-55008917 GGATAGTCTGTGATGGACCATGG - Intergenic
1041496268 8:58488430-58488452 GGATATGATGGGATGGTGCATGG + Intergenic
1041683967 8:60625391-60625413 TGATTTCCTGAGTTGGGGCAGGG + Intergenic
1045245036 8:100435366-100435388 GGGCAGCCTGAGATGGGGCAAGG + Intergenic
1047284195 8:123472453-123472475 GGACAACTTCAGATGGAGCATGG - Intergenic
1049233542 8:141496495-141496517 GGAGATTCTGAAATGGAGGAGGG + Intergenic
1049534283 8:143170959-143170981 GCATAACCTGGGATGGGGCAAGG + Intergenic
1051418039 9:16863206-16863228 GAATATATTGAGATGGGGCAGGG - Intronic
1053027543 9:34742406-34742428 GGAAATGCTGAGAGTGAGCAAGG - Intergenic
1055053409 9:72001558-72001580 GGATTACCTGAGATAAAGCAGGG - Intergenic
1055727915 9:79251237-79251259 AGATTTCCTGAGAAGGAGAAAGG - Intergenic
1056028486 9:82525835-82525857 TGGTAAACTGAGATGGAGCATGG + Intergenic
1059102238 9:111482995-111483017 GGTGACCCTCAGATGGAGCAGGG - Intronic
1059958752 9:119544878-119544900 GGAAATCATCAGATGGAGGAGGG - Intergenic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1062724616 9:138064815-138064837 GGAGATGCTGTCATGGAGCAGGG - Intronic
1185770581 X:2762789-2762811 GGAGAGAGTGAGATGGAGCAAGG + Intronic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1190311939 X:49122892-49122914 GGAGATCCAGACATGGAGTAGGG - Intronic
1191142241 X:57127728-57127750 GGACATCCTGAGAGGTGGCAAGG - Intergenic
1194394244 X:93361089-93361111 GGGTATGCTGACATGGAGAAGGG + Intergenic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196198000 X:112855363-112855385 GGAAGTGCTGAGATCGAGCAAGG + Intergenic
1199432166 X:147773931-147773953 GGATATCCTGTGATATAGAATGG - Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201235660 Y:11908415-11908437 GAAGAGCCTGAGATGGAGTAAGG - Intergenic