ID: 1061178132

View in Genome Browser
Species Human (GRCh38)
Location 9:129009442-129009464
Sequence CGGCTACTCACATGGCACCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 84}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061178122_1061178132 -2 Left 1061178122 9:129009421-129009443 CCAGGAGCCCCACTCCAGCCCCG 0: 1
1: 2
2: 7
3: 74
4: 652
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178117_1061178132 6 Left 1061178117 9:129009413-129009435 CCCCAGCCCCAGGAGCCCCACTC 0: 1
1: 0
2: 8
3: 88
4: 696
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178111_1061178132 25 Left 1061178111 9:129009394-129009416 CCCAGAGGCAAACTCCCCTCCCC 0: 1
1: 0
2: 1
3: 23
4: 237
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178116_1061178132 9 Left 1061178116 9:129009410-129009432 CCTCCCCAGCCCCAGGAGCCCCA 0: 1
1: 0
2: 19
3: 189
4: 1131
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178118_1061178132 5 Left 1061178118 9:129009414-129009436 CCCAGCCCCAGGAGCCCCACTCC 0: 1
1: 0
2: 4
3: 66
4: 577
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178119_1061178132 4 Left 1061178119 9:129009415-129009437 CCAGCCCCAGGAGCCCCACTCCA 0: 1
1: 0
2: 5
3: 61
4: 527
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178112_1061178132 24 Left 1061178112 9:129009395-129009417 CCAGAGGCAAACTCCCCTCCCCA 0: 1
1: 0
2: 0
3: 42
4: 304
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178125_1061178132 -10 Left 1061178125 9:129009429-129009451 CCCACTCCAGCCCCGGCTACTCA 0: 1
1: 0
2: 2
3: 24
4: 370
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178114_1061178132 11 Left 1061178114 9:129009408-129009430 CCCCTCCCCAGCCCCAGGAGCCC 0: 1
1: 1
2: 26
3: 245
4: 1542
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178121_1061178132 -1 Left 1061178121 9:129009420-129009442 CCCAGGAGCCCCACTCCAGCCCC 0: 1
1: 1
2: 7
3: 77
4: 620
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178115_1061178132 10 Left 1061178115 9:129009409-129009431 CCCTCCCCAGCCCCAGGAGCCCC 0: 1
1: 0
2: 25
3: 252
4: 1646
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178110_1061178132 26 Left 1061178110 9:129009393-129009415 CCCCAGAGGCAAACTCCCCTCCC 0: 2
1: 0
2: 4
3: 28
4: 263
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178124_1061178132 -9 Left 1061178124 9:129009428-129009450 CCCCACTCCAGCCCCGGCTACTC 0: 1
1: 0
2: 6
3: 48
4: 883
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84
1061178120_1061178132 0 Left 1061178120 9:129009419-129009441 CCCCAGGAGCCCCACTCCAGCCC 0: 1
1: 0
2: 4
3: 85
4: 609
Right 1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG 0: 1
1: 0
2: 0
3: 0
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061178132 Original CRISPR CGGCTACTCACATGGCACCC TGG Exonic
902166898 1:14579785-14579807 GGGGGACTCACATGGCAGCCAGG + Intergenic
902655102 1:17861549-17861571 CAGCAACATACATGGCACCCAGG + Intergenic
904035631 1:27557143-27557165 CGCCCACACACCTGGCACCCAGG - Intronic
905576238 1:39046914-39046936 GGGCTAGTCACATGGCACTGTGG + Intergenic
908171598 1:61510696-61510718 AGCCTATTCACATGGCACCTTGG + Intergenic
911060383 1:93742489-93742511 CTGCTACTCCCAGGGGACCCTGG + Intronic
912412911 1:109490301-109490323 CGGCTAAACACATAGCATCCTGG - Exonic
921364999 1:214365231-214365253 GGGCTACTCACATAGCCCCGTGG - Intronic
1076338301 10:129725368-129725390 CGGCTACTGACATGGAACTTCGG - Intronic
1084374916 11:68769971-68769993 CGGCTGCTCACTCGGCTCCCAGG - Intronic
1085310503 11:75513894-75513916 CGGCAGCTCCCATGGCACCTGGG - Intronic
1087104189 11:94394106-94394128 AGGCTGCTCGCATGGCACCACGG + Intronic
1092409134 12:8240923-8240945 TGGCTACTCAGCTGCCACCCAGG + Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1113561866 13:111287615-111287637 AGGCTGCTCAAATGGCGCCCTGG - Intronic
1113807623 13:113118777-113118799 CGGCTACTCGGATGGCAGCAAGG + Exonic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1129727608 15:77909524-77909546 TGGCCTCTCCCATGGCACCCAGG - Intergenic
1129840275 15:78739446-78739468 TGGCCTCTCCCATGGCACCCAGG + Intergenic
1130275917 15:82476308-82476330 TGGCCTCTCTCATGGCACCCAGG - Intergenic
1130468279 15:84203700-84203722 TGGCCTCTCTCATGGCACCCAGG - Intergenic
1130495987 15:84469842-84469864 TGGCCTCTCTCATGGCACCCAGG + Intergenic
1130590572 15:85208298-85208320 TGGCCTCTCTCATGGCACCCAGG - Intergenic
1139674229 16:68511844-68511866 CAGCTACTCACCTGGCAGGCAGG + Intergenic
1142216479 16:88832391-88832413 CAGCTGCGCACGTGGCACCCAGG - Intronic
1148507734 17:48141488-48141510 CAGCTACTCAGATTGAACCCAGG - Intronic
1149052391 17:52322029-52322051 CTTCTACTCACATATCACCCAGG - Intergenic
1152471984 17:80494606-80494628 CTGCTCCTCTCATGGCTCCCTGG - Intergenic
1156401237 18:36742271-36742293 CGGCTAGCCACCTGGCAGCCTGG - Intronic
1157601164 18:48894014-48894036 CGGCTGCCCGCCTGGCACCCTGG + Intergenic
1158546042 18:58397979-58398001 TGGCTTCTCACATGCCAGCCAGG - Intronic
1162529881 19:11229624-11229646 CGTCTACTCCCACAGCACCCTGG - Intronic
933571355 2:84017055-84017077 CCACTACTCACATGGACCCCAGG + Intergenic
934756389 2:96827602-96827624 CAGCTGCTCACAGGCCACCCGGG + Intronic
941593992 2:167452858-167452880 AGGTGACTCTCATGGCACCCAGG - Intergenic
946217342 2:218194758-218194780 CCCCGACTCACATGGCACCTAGG + Intergenic
1169633544 20:7661799-7661821 TGGCTACTGACATTGCACTCTGG - Intergenic
1171508529 20:25660055-25660077 AGGCTACTGACATGGGACACTGG + Intergenic
1173877545 20:46384374-46384396 TGGTTAGTCACATGGTACCCAGG + Intronic
1175979153 20:62728286-62728308 CGGCTACTCAGCTGGACCCCAGG + Intronic
1180181487 21:46120444-46120466 CCGCCTCTCACATGGGACCCAGG + Intronic
1180839207 22:18950995-18951017 GAGCTGCTCACAGGGCACCCGGG - Intergenic
1181006325 22:20015415-20015437 CGGCCACTGGCATGGCACACCGG + Intronic
1181055456 22:20258665-20258687 CTGCTACTCCCCTGGCTCCCAGG + Intronic
1181468693 22:23125046-23125068 CAGCTACACACATAGCACACTGG - Intronic
1182393335 22:30017936-30017958 AGGTTACGCACATGGCACACAGG - Exonic
1184661840 22:45969056-45969078 GGCCTACTCCCATGGCACCATGG - Intronic
950730277 3:14950239-14950261 CAGCTAGTTACATGGCATCCAGG + Intronic
956197580 3:66668725-66668747 TGGTAACTCACATGGCACACTGG - Intergenic
967992807 3:195144279-195144301 TGGCTAATCACATGCCATCCAGG + Intronic
968137354 3:196228725-196228747 CGGCTCCTCACAGGGCTCCTGGG - Intronic
969756808 4:9155283-9155305 TGGCTACTCAGTTGCCACCCAGG - Intergenic
979743345 4:124179041-124179063 GTGCTACTTACATGGCACCATGG - Intergenic
990173415 5:53080739-53080761 CTGCTAGTCAGTTGGCACCCAGG - Intronic
999141799 5:149367355-149367377 CGGCTAGTGACATGGCTCCTGGG - Exonic
1006452595 6:34113766-34113788 CTGGTCCTCACATGGCAGCCAGG + Intronic
1010524654 6:76885831-76885853 CTGCTACTCAGTTGTCACCCAGG - Intergenic
1021174221 7:17432055-17432077 CGGCTGCTCACATGGGTCACTGG - Intergenic
1023830490 7:44036456-44036478 AGGCCACTCCCATAGCACCCAGG + Intergenic
1029740812 7:102490750-102490772 AGGCCACTCCCATAGCACCCAGG + Intronic
1029758806 7:102589923-102589945 AGGCCACTCCCATAGCACCCAGG + Intronic
1032357697 7:131225709-131225731 GGGCTACTCTCAAGGCTCCCCGG + Intronic
1034488399 7:151380510-151380532 CAGCTTCTCTCCTGGCACCCGGG + Intronic
1035625901 8:1070326-1070348 CCGCTGCTCACCAGGCACCCGGG - Intergenic
1035722408 8:1802117-1802139 CGGATGCTCACATGGGAGCCTGG - Intergenic
1036182458 8:6597222-6597244 TGGCTGCTCACAAGGCACCATGG + Intronic
1036380040 8:8230603-8230625 TGGCTACTCAGCTGCCACCCAGG - Intergenic
1036382496 8:8246231-8246253 CAGCTACTCACATGGGAGTCAGG - Intergenic
1036822612 8:11952580-11952602 TGGCTGAGCACATGGCACCCGGG - Intergenic
1036849519 8:12192059-12192081 TGGCTACTCAGCTGCCACCCAGG + Intronic
1036870881 8:12434332-12434354 TGGCTACTCAGCTGCCACCCAGG + Intronic
1037543482 8:19894857-19894879 CTGCTACTTATATGTCACCCTGG - Intergenic
1043864712 8:85361643-85361665 GGGCATCTCACATTGCACCCAGG - Intronic
1049166469 8:141128882-141128904 CGCCAACCCACAGGGCACCCGGG - Intronic
1052293678 9:26873214-26873236 CAGCTGCTCACTTGTCACCCTGG - Intronic
1053478826 9:38401202-38401224 CAGCTACTCAGGAGGCACCCAGG - Intergenic
1061061830 9:128254372-128254394 TGGCCTCTCACACGGCACCCAGG - Intronic
1061178132 9:129009442-129009464 CGGCTACTCACATGGCACCCTGG + Exonic
1062601279 9:137319657-137319679 CGGGTGCGCACATGGGACCCTGG + Intronic
1186477455 X:9868674-9868696 CAGCTACTCAGGAGGCACCCAGG - Intronic
1188483039 X:30653622-30653644 CGCCTCTTCACATGTCACCCCGG - Intronic
1202142601 Y:21743828-21743850 CTTCTACTCAGATGCCACCCAGG - Intergenic
1202144257 Y:21761790-21761812 CTTCTACTCAGATGCCACCCAGG + Intergenic
1202367943 Y:24179625-24179647 TGGCGTCTCTCATGGCACCCAGG + Intergenic
1202502840 Y:25490492-25490514 TGGCGTCTCTCATGGCACCCAGG - Intergenic