ID: 1061178391

View in Genome Browser
Species Human (GRCh38)
Location 9:129010550-129010572
Sequence TAACCCCTCCCCAGTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061178380_1061178391 17 Left 1061178380 9:129010510-129010532 CCCCACAGAGGGGAAACTGAGGC 0: 2
1: 3
2: 11
3: 64
4: 357
Right 1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 181
1061178388_1061178391 -6 Left 1061178388 9:129010533-129010555 CCAGGGAGGGAAAGCAGTAACCC 0: 1
1: 0
2: 2
3: 20
4: 156
Right 1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 181
1061178387_1061178391 -5 Left 1061178387 9:129010532-129010554 CCCAGGGAGGGAAAGCAGTAACC 0: 1
1: 0
2: 1
3: 18
4: 171
Right 1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 181
1061178382_1061178391 15 Left 1061178382 9:129010512-129010534 CCACAGAGGGGAAACTGAGGCCC 0: 3
1: 9
2: 24
3: 111
4: 438
Right 1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 181
1061178381_1061178391 16 Left 1061178381 9:129010511-129010533 CCCACAGAGGGGAAACTGAGGCC 0: 1
1: 0
2: 18
3: 62
4: 409
Right 1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061178391 Original CRISPR TAACCCCTCCCCAGTGGGTG TGG Intronic
900109118 1:998242-998264 TTCCGCCTCCCCAGTGGGTGAGG - Intergenic
900673395 1:3869613-3869635 CTACCCCTCCACGGTGGGTGCGG + Exonic
901646339 1:10718703-10718725 TGCCCACTCCCCAGTGGGTCAGG - Intronic
904460900 1:30679340-30679362 TCACCCCTTCCAAGTTGGTGGGG + Intergenic
904670173 1:32158681-32158703 TAACCCCTTCCCAGTAGTGGGGG - Intronic
905379907 1:37554367-37554389 TGACTACTCCCTAGTGGGTGTGG + Intergenic
907045967 1:51300215-51300237 TAACTTCTCCTCACTGGGTGTGG + Intronic
909798698 1:79778166-79778188 TAAACCCTTCCCATTGGGTTGGG + Intergenic
910392907 1:86762848-86762870 GAGCCCCTCCCCAGTGTGAGAGG - Intergenic
915164645 1:153941834-153941856 TAACCCCTTCCCAATGGCAGAGG + Intronic
915556611 1:156664386-156664408 TTAGCTCTCCCCTGTGGGTGGGG + Intergenic
917282850 1:173395915-173395937 TTACCCACCCCCAGTGGGAGTGG + Intergenic
917475141 1:175362910-175362932 TCATCCCTCCCCACTGAGTGCGG - Intronic
918141506 1:181723992-181724014 TCACCCCTCCCCAGGGGTTGTGG + Intronic
918248470 1:182681142-182681164 ACACCTCTCCCCACTGGGTGTGG - Intronic
920377146 1:205515057-205515079 TCACCCCTCCCCAGAAGGTCTGG - Intronic
922744779 1:228037714-228037736 TTAACTCTCCCCAGTGGGAGGGG + Intronic
1063552127 10:7043235-7043257 TGGCCCCTGCCCAGTGGGTGTGG - Intergenic
1063574916 10:7252942-7252964 TCTCCCCTCCCTAGTGGGTGTGG - Intronic
1066188781 10:33036822-33036844 TGACCCCTACCGAGTTGGTGGGG + Intergenic
1069703364 10:70441775-70441797 TAACCCCCCTCCGGAGGGTGGGG + Intronic
1071017298 10:81012649-81012671 TCTCCCCTCCCCAGAGGATGAGG + Intergenic
1075896906 10:126004126-126004148 TAGTCCATCCCCAGTTGGTGGGG - Intronic
1075932532 10:126311597-126311619 TCTCCCCTCCCCAGAGGATGGGG - Intronic
1076166979 10:128290506-128290528 TAACCCCTCCCCTTTGAGTGTGG - Intergenic
1078909399 11:15717078-15717100 CAACCCCTCTCCAGTTAGTGAGG + Intergenic
1079310798 11:19364054-19364076 TCTCCCCTCCCCAGAGGGTGGGG + Intronic
1080116880 11:28631328-28631350 AATCCCCTCCCCTTTGGGTGTGG - Intergenic
1083273271 11:61582718-61582740 TGGCCCTTCCCCAGAGGGTGAGG - Intergenic
1083297942 11:61725333-61725355 AACCCCATCCCCAGTGGGTCTGG - Intronic
1083323499 11:61861914-61861936 CTCCCCCTCTCCAGTGGGTGGGG + Intronic
1083884822 11:65567680-65567702 TAATCCCACTCCAGTGGGTGAGG + Intergenic
1084648544 11:70474659-70474681 CCTCCCCTCCCCAGTGGCTGTGG - Intronic
1085637853 11:78172091-78172113 GGACCCCTGCCCAGTGGGGGAGG + Exonic
1087638248 11:100727528-100727550 TCTCCCCTTCCCAGAGGGTGGGG - Intronic
1089630860 11:119783364-119783386 TAAGCCCTCCCGTGAGGGTGGGG + Intergenic
1090187990 11:124750831-124750853 GAACCCCCCCACAGTGGGGGTGG - Exonic
1092203787 12:6603441-6603463 TTCCCTCTCCTCAGTGGGTGAGG - Intronic
1095469860 12:42525095-42525117 AACCCCTTCCCCAGTGGCTGGGG - Intronic
1095780173 12:46049972-46049994 TTACCCCTCCCCACTGGGAAGGG + Intergenic
1095780177 12:46049976-46049998 TACCCCCTTCCCAGTGGGGAGGG - Intergenic
1096143833 12:49264694-49264716 TGCCCCGTCCCCGGTGGGTGCGG - Intronic
1100028127 12:90153581-90153603 TCATCCCTCCTCACTGGGTGTGG + Intergenic
1103228474 12:119308055-119308077 AAAGCCCTCCCCAGTGTGGGTGG + Intergenic
1103360902 12:120353110-120353132 AAACCCCTCCCCAGAAGCTGGGG - Intronic
1104477444 12:129082262-129082284 AAACCCCTCACCAGGAGGTGAGG - Intronic
1104976471 12:132554179-132554201 TGACCCCTCCCAAGGCGGTGAGG - Intronic
1105323572 13:19349828-19349850 TAGCCCATCCCCAGAGTGTGCGG + Intergenic
1105870379 13:24499672-24499694 TAGCCCATCCCCAGAGTGTGCGG - Intronic
1113562166 13:111290512-111290534 GAACCAATCCCCTGTGGGTGAGG + Intronic
1113597886 13:111547459-111547481 AGACCCCTCCCCAGGTGGTGGGG + Intergenic
1113876076 13:113595561-113595583 TACCCACTCCCCTGTGGTTGGGG + Intronic
1118952836 14:70450057-70450079 TGACACCACCCCAGTGAGTGGGG + Intergenic
1119856684 14:77906356-77906378 TAACCCCTCCCTCCTGGCTGTGG + Intronic
1121553489 14:94819604-94819626 TAGCCCCACCCAAGAGGGTGAGG + Intergenic
1123806523 15:23879635-23879657 TAATCCCCTCCCAGTGCGTGTGG - Intergenic
1124570141 15:30855581-30855603 TAGCCCCTTCCCAGGGTGTGGGG - Intergenic
1128856254 15:71019193-71019215 TCTCCCCTCCCCAGAGGTTGGGG + Intronic
1129188052 15:73922570-73922592 TCACCCCTCCCCAGAGTCTGGGG - Intergenic
1129330854 15:74826513-74826535 AAACCCCTCCTCACTGGGGGCGG - Intergenic
1131069002 15:89452618-89452640 GAACCCTCCCCCAGAGGGTGGGG - Intergenic
1131234409 15:90683549-90683571 TCACCCCTCCCCCATGGGTGTGG + Intergenic
1131524454 15:93141824-93141846 TAACTCCTCCTCTGTGGCTGTGG - Intergenic
1132494170 16:252810-252832 TGACCCTTCCCCAGAGGGTGCGG + Intronic
1132908943 16:2298674-2298696 AAAGCCCACCCCAGTGGGAGTGG - Intronic
1133248231 16:4463314-4463336 CGACCCCTCCCCTGTGGGAGGGG - Intronic
1133284740 16:4685399-4685421 GAGACCCTCCCCTGTGGGTGGGG - Intronic
1136579565 16:31143248-31143270 CAGCCCCTCCCCAGGGGGTGTGG - Intronic
1140972477 16:80027109-80027131 AACCCCCTCCCCAGTCTGTGGGG + Intergenic
1142127857 16:88419172-88419194 TAGCCTCTCCCCGATGGGTGTGG - Intergenic
1142195412 16:88737258-88737280 CAACCCCTCCCCAGAGAATGTGG - Intronic
1143380724 17:6494496-6494518 TAACCCCTGCCAAGTGTGTGCGG + Intronic
1143573126 17:7773471-7773493 GAACATATCCCCAGTGGGTGGGG - Intronic
1143612336 17:8025976-8025998 TAAACCCTCCCCAGTGGACACGG + Intergenic
1145017752 17:19410263-19410285 TCACCCCTCCCAACTGGGTGCGG - Intergenic
1145231657 17:21177619-21177641 TGACCCCTCCCCAGCCAGTGAGG + Intronic
1146684000 17:34828146-34828168 GAACCCCTTCCCAGTGGAAGGGG + Intergenic
1148284201 17:46373199-46373221 TAAGCCCTCGCAAGGGGGTGCGG - Intergenic
1148306422 17:46591120-46591142 TAAGCCCTCGCAAGGGGGTGCGG - Intronic
1149572381 17:57682326-57682348 GCACCCCTTCACAGTGGGTGGGG - Exonic
1150034359 17:61777869-61777891 CAAGCCCTCCCCAGAGGTTGAGG + Intronic
1150432535 17:65129836-65129858 TCACCCATCCTCAGTGGGTGTGG + Intergenic
1151493826 17:74447723-74447745 GAACCCCCCTCCAGTGGCTGTGG + Intronic
1152398459 17:80049517-80049539 TTTCCCCTTGCCAGTGGGTGGGG - Intronic
1152652349 17:81500632-81500654 TAATCCCAACCCAGAGGGTGAGG + Intergenic
1152855345 17:82662497-82662519 AACCCCAGCCCCAGTGGGTGTGG + Intronic
1153682556 18:7514304-7514326 TAATCCCTTCCCATTGAGTGTGG - Intergenic
1154346718 18:13548741-13548763 TAACCCTTTCCAAGTTGGTGGGG - Intronic
1156695790 18:39765105-39765127 TCTCCCCTCCCCAGAGGTTGAGG + Intergenic
1157315956 18:46589830-46589852 TAATCCCTCCTCAGTTGATGAGG + Intronic
1160942682 19:1627727-1627749 GAAGCCCTGCCCAGGGGGTGGGG + Intronic
1161084664 19:2329189-2329211 TAACCTCACCCTAGGGGGTGCGG + Intronic
1161819717 19:6522379-6522401 AGGCCCTTCCCCAGTGGGTGAGG + Intergenic
1163520774 19:17790384-17790406 CCACACCTGCCCAGTGGGTGTGG + Intergenic
1164325047 19:24183946-24183968 TAACACCTCCCCAGTTGGCTGGG + Intergenic
1164578089 19:29417799-29417821 AAGACCCTCCCCAGGGGGTGCGG + Intergenic
1165905845 19:39194162-39194184 TAACCAGTGCCCAGCGGGTGGGG - Intergenic
1167001306 19:46746875-46746897 TAACCCTTCCCCAGCGGTGGGGG + Exonic
1168012739 19:53546372-53546394 TAATTCCTCCCCAGGGGATGTGG + Intronic
926129418 2:10292407-10292429 ACACTCCTCCCCAGTGTGTGTGG + Intergenic
926740174 2:16104000-16104022 GAACACCTCACCAGTGGGAGGGG + Intergenic
929546046 2:42855780-42855802 GCAGCCCTCCCCAGTGGATGCGG - Intergenic
929670631 2:43874513-43874535 TACCCCCACCCTGGTGGGTGGGG - Intronic
933129498 2:78655229-78655251 GACCCCCTCCCCACTGGGCGGGG + Intergenic
933149867 2:78901624-78901646 TCTCCCCTCCCCAGAGGATGGGG + Intergenic
934945385 2:98537525-98537547 TCACCCCTGCCCAGAGGGTGAGG - Intronic
935038661 2:99404320-99404342 CCTCCCCTCCCCAGTGGATGTGG + Intronic
935281951 2:101526028-101526050 TACCCTCTCCCCATTGGCTGGGG + Intergenic
936026158 2:109032573-109032595 TCTCCCCTCCCCATGGGGTGGGG + Intergenic
940736011 2:157453432-157453454 TAACTCCTGCCCAATGGGCGTGG + Intronic
943943600 2:194029786-194029808 AAACCCCTTCCCTGGGGGTGAGG + Intergenic
945818861 2:214638508-214638530 TTCCCCCTCCCCAGGGAGTGGGG - Intergenic
948295498 2:236857270-236857292 TAACCCAGCCCCAGAGAGTGGGG - Intergenic
948318089 2:237045689-237045711 TAAATCCTCCCCAGATGGTGGGG + Intergenic
948607519 2:239145553-239145575 TAACCTCTCCCGGGTGGGTTTGG - Intronic
1169572341 20:6920041-6920063 ACACCCCTCCCCAGTGGGACAGG - Intergenic
1174084260 20:47994239-47994261 TCACCCCTTCCCTGTGGGTCTGG + Intergenic
1179622941 21:42630802-42630824 TGTCCCCTCCACAGTGGGAGGGG + Intergenic
1179774362 21:43651161-43651183 TAACACCTCCTCAGATGGTGTGG - Intronic
1180155421 21:45975050-45975072 TGCCCCCTCCCCAGTGACTGTGG - Intergenic
1182366685 22:29783903-29783925 TCCCCCCTCCCCTGGGGGTGGGG - Intergenic
1184993091 22:48183664-48183686 AATCACCTCCCCTGTGGGTGAGG - Intergenic
949543192 3:5050356-5050378 CAACCCCTCCCGGCTGGGTGCGG + Intergenic
950527452 3:13532804-13532826 TCCCCCCTCCCCACTGGGTTTGG + Intergenic
951130971 3:19044681-19044703 TATCCCCTCACAAGTGGTTGAGG + Intergenic
951443730 3:22752308-22752330 TAACCTCACCGAAGTGGGTGGGG + Intergenic
957374624 3:79340033-79340055 TCACACCTGCCAAGTGGGTGGGG - Intronic
957458580 3:80487206-80487228 TAACTCCTCCCCAGTGAGGCTGG + Intergenic
960005376 3:112776094-112776116 AAACAGCTCACCAGTGGGTGAGG - Intronic
962940463 3:140120540-140120562 TCTCCCCTCCCCAGAGGTTGGGG + Intronic
963005507 3:140723207-140723229 CCACCCCTCCACACTGGGTGAGG + Intergenic
965080274 3:164024170-164024192 TAACTCCTTCCCAGCAGGTGGGG + Intergenic
965969245 3:174533159-174533181 TACCCCTTCCCCATTGGCTGGGG - Intronic
967700394 3:192585623-192585645 CAACCCCTCCTCAGTAAGTGGGG - Intronic
967981944 3:195071118-195071140 TGGCCCCTCCTCTGTGGGTGTGG - Intronic
969057884 4:4413534-4413556 AAACCCCTTCCCACTGGGTCAGG - Intronic
970520527 4:16879443-16879465 ACAGCCCTCCCCAGTGGGGGTGG + Intronic
971574259 4:28253916-28253938 TCATCCCTCCTCACTGGGTGGGG + Intergenic
974249347 4:59363604-59363626 TCACCGCTTCCCAGTGGGGGAGG + Intergenic
985480149 5:104982-105004 GAAACACTCCACAGTGGGTGAGG + Intergenic
985480172 5:105102-105124 GAAACACTCCACAGTGGGTGAGG + Intergenic
985480184 5:105162-105184 GAAACACTCCGCAGTGGGTGAGG + Intergenic
985727908 5:1525270-1525292 TCACCCCATCCCCGTGGGTGTGG - Intergenic
989126178 5:38054413-38054435 TCTCCCCTCCCCAGAGGATGGGG - Intergenic
991331523 5:65497605-65497627 TATCCCCTTCCCATTAGGTGTGG - Intergenic
992228553 5:74641384-74641406 TCCCCACTCCCCAGTGGGTGCGG + Exonic
996456921 5:123695204-123695226 TAGCCACTCCCCAGTGTGGGTGG - Intergenic
997467429 5:134097641-134097663 CAGCCCCTCCACCGTGGGTGAGG - Intergenic
997828334 5:137127526-137127548 TACCCCTACCCCAGTGGGTCTGG + Intronic
998476547 5:142427075-142427097 TATCCCCTCTCCAGGGGCTGCGG + Intergenic
999678298 5:154029533-154029555 AAACTCCTCCCCAGTGGCTGGGG - Exonic
1000580608 5:163031348-163031370 TAATCCCTCCCCAGAGGTTGTGG - Intergenic
1002308032 5:178295515-178295537 TATCCTCTCACCAGTGTGTGAGG - Intronic
1004506824 6:16253606-16253628 TGACCCCCCCCCAGTGGAGGTGG - Intronic
1004883176 6:20028358-20028380 TCACCCCAGCCCTGTGGGTGTGG + Intergenic
1004906606 6:20242412-20242434 TCTCCCCTCCCTGGTGGGTGGGG + Intergenic
1006638963 6:35479273-35479295 ACAGCCCTCCCCAGTGGGAGTGG - Intronic
1009848265 6:69162024-69162046 GAACCCCTTCCCACTGAGTGTGG - Intronic
1010022735 6:71179700-71179722 TATGCCCTCCCCATTTGGTGGGG + Intergenic
1012853601 6:104475335-104475357 TAATCCCTTCCCATTGAGTGTGG - Intergenic
1014422314 6:121261055-121261077 TCAACCCTCCTCACTGGGTGGGG + Intronic
1017250234 6:152272347-152272369 TCACCAGTCCCCACTGGGTGGGG + Intronic
1018746175 6:166764140-166764162 CACGCCCTCCCCAGTGGGAGTGG - Intronic
1019925495 7:4189433-4189455 CAGCCACTCCCCATTGGGTGTGG - Intronic
1020006975 7:4788343-4788365 GAGCCCCACCCCAGTGGCTGTGG - Intronic
1028821272 7:95214597-95214619 TAATCCCTTCCCACTGAGTGAGG - Intronic
1033738021 7:144243995-144244017 TCTCCCCTCCCCAGAGGTTGAGG - Intergenic
1033745034 7:144306962-144306984 TCTCCCCTCCCCAGAGGTTGAGG + Intergenic
1034227910 7:149497419-149497441 GAACCCCTCCCCAGGGCCTGCGG + Intronic
1034324870 7:150220884-150220906 TAACCCCTGCTGGGTGGGTGGGG - Intergenic
1034768325 7:153748349-153748371 TAACCCCTGCTGGGTGGGTGGGG + Intergenic
1035047701 7:155980160-155980182 TCACCCCTCTCCACTGGGTTAGG + Intergenic
1035345728 7:158196482-158196504 TCACCCCTCCTCAGGGGCTGGGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037963112 8:23114688-23114710 TAACCCGTGCACAGAGGGTGTGG + Exonic
1037967999 8:23148498-23148520 TAACCCGTGCACAGAGGGTGTGG - Exonic
1039587297 8:38718072-38718094 TGACCCCTACGCAGTGTGTGTGG + Intergenic
1042131342 8:65589459-65589481 TTTCCCCTCCCCAGAGGGTCAGG - Intergenic
1043524652 8:81083277-81083299 TAACACCACCCCAGTTGGAGAGG + Intronic
1044645383 8:94436985-94437007 TAAACCCTCCCCTGTAGGCGTGG - Intronic
1045186493 8:99843575-99843597 TAACCCCTCCACTGTGGAAGGGG + Intronic
1047658775 8:127009419-127009441 TAACTTCTCACCAGTGTGTGGGG - Intergenic
1049270046 8:141690713-141690735 GGACCCCTCCTCAGTGGGTGGGG + Intergenic
1049640390 8:143712566-143712588 TAAGCCAGCCCCAGTGGGTGGGG - Intronic
1054961836 9:70977996-70978018 TTTCCCCTCCCCAGAGGTTGAGG + Intronic
1056378978 9:86040436-86040458 TAACCCCTCCCATGGGGCTGGGG + Intronic
1057512149 9:95689739-95689761 TTTCCTCTCCCCTGTGGGTGTGG + Intergenic
1059476928 9:114554771-114554793 TGTCCCCTCCCCAGTGGGACTGG + Intergenic
1061178391 9:129010550-129010572 TAACCCCTCCCCAGTGGGTGTGG + Intronic
1186468633 X:9804142-9804164 TGACAACTCCCCAGTGGATGAGG + Intronic
1187953769 X:24495742-24495764 TCTCCCCTCCCCAGAGGTTGAGG + Intronic
1189277500 X:39797464-39797486 TCACCCCTCCCTTATGGGTGGGG + Intergenic
1189312372 X:40028760-40028782 TCTCCCCTCCCCAGAGGTTGGGG - Intergenic
1189855808 X:45223886-45223908 TGACACCACCCCGGTGGGTGGGG + Intergenic
1192980180 X:76330791-76330813 CAATCCCTCCTCACTGGGTGGGG + Intergenic
1193427235 X:81354875-81354897 TATCCCCACCCCACTGGCTGAGG + Intergenic
1194930411 X:99880925-99880947 TCATCCCTCCTCACTGGGTGGGG + Intergenic
1195312059 X:103641236-103641258 TGTCCCCTCACCAGTGTGTGAGG - Intergenic
1196555848 X:117083849-117083871 TCACCCCTCCTCACTGGGTAGGG - Intergenic
1197035528 X:121869951-121869973 CACCCCCTTCCAAGTGGGTGGGG + Intergenic
1200231629 X:154446590-154446612 GGACCCCTCCCCAGGGGCTGCGG - Intronic