ID: 1061178479

View in Genome Browser
Species Human (GRCh38)
Location 9:129010848-129010870
Sequence CCAGCCCCCAGCTCCCATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 0, 2: 3, 3: 91, 4: 757}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061178479_1061178489 15 Left 1061178479 9:129010848-129010870 CCGGCATGGGAGCTGGGGGCTGG 0: 1
1: 0
2: 3
3: 91
4: 757
Right 1061178489 9:129010886-129010908 TAACATGCCTCATGCAGGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1061178479_1061178491 28 Left 1061178479 9:129010848-129010870 CCGGCATGGGAGCTGGGGGCTGG 0: 1
1: 0
2: 3
3: 91
4: 757
Right 1061178491 9:129010899-129010921 GCAGGAGGGGAGCAGCCAGCAGG 0: 1
1: 0
2: 15
3: 105
4: 735
1061178479_1061178487 13 Left 1061178479 9:129010848-129010870 CCGGCATGGGAGCTGGGGGCTGG 0: 1
1: 0
2: 3
3: 91
4: 757
Right 1061178487 9:129010884-129010906 TCTAACATGCCTCATGCAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 142
1061178479_1061178485 10 Left 1061178479 9:129010848-129010870 CCGGCATGGGAGCTGGGGGCTGG 0: 1
1: 0
2: 3
3: 91
4: 757
Right 1061178485 9:129010881-129010903 CCCTCTAACATGCCTCATGCAGG 0: 1
1: 0
2: 0
3: 10
4: 109
1061178479_1061178488 14 Left 1061178479 9:129010848-129010870 CCGGCATGGGAGCTGGGGGCTGG 0: 1
1: 0
2: 3
3: 91
4: 757
Right 1061178488 9:129010885-129010907 CTAACATGCCTCATGCAGGAGGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061178479 Original CRISPR CCAGCCCCCAGCTCCCATGC CGG (reversed) Intronic
900285298 1:1896225-1896247 CCAGCCCCTGCCTCCCTTGCAGG + Intergenic
900342999 1:2197468-2197490 CCAGCCCTGAGGTCCCCTGCAGG - Intronic
900594867 1:3476175-3476197 CCAGCCCCCAGGCCTCATGAGGG - Intronic
900604715 1:3518853-3518875 TCATCCCCCAGCTCCCCTCCAGG + Intronic
900659590 1:3775929-3775951 CCAGCCCCCCGCGTGCATGCGGG - Exonic
900700864 1:4047917-4047939 CCAACCCCCCACCCCCATGCAGG - Intergenic
900965719 1:5956908-5956930 CCTGCCCCCAGCTCACATCGTGG + Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
901055240 1:6446142-6446164 TCACCCCCCAGCTCCCATGGAGG - Intronic
901302730 1:8211326-8211348 CCAGCACCCAGCACCCACGCAGG + Intergenic
901672850 1:10866353-10866375 CCAGCCCTCAGCTCCAGGGCCGG - Intergenic
901753150 1:11424366-11424388 CCAGGCCCCCGCTCCAATGCTGG - Intergenic
902232143 1:15034925-15034947 CCAGCTCCCACCTCCCCTGCTGG + Intronic
902301062 1:15503009-15503031 CCTGCCCCCCGCTCCCACCCCGG - Intronic
902479131 1:16702472-16702494 TCACCCCCCAGCTCCCATGGAGG + Intergenic
902747854 1:18485065-18485087 CCAGCCCACAGGTCCCTTGGAGG - Exonic
902836930 1:19053530-19053552 CCAGCCCCCAGCCCTCCTGCCGG + Intergenic
902985374 1:20151394-20151416 CCAGGACCCAGCTGCCCTGCGGG - Intergenic
903285648 1:22275191-22275213 CCAGGTCCCAGCTCCTAGGCTGG - Intergenic
903544694 1:24116644-24116666 GCAGCCCCCACCTCCCCTGCTGG - Intergenic
903654774 1:24942571-24942593 CCAGCCCCCTTCTCCCTTCCTGG - Intronic
903770301 1:25759517-25759539 TCATCTCCCAGCTCCCATACTGG - Intronic
903855653 1:26336489-26336511 CCCGCCCCAAGCGCCCAGGCAGG + Intronic
903998708 1:27324937-27324959 CCAGCCCCCACCTCCAATATGGG + Intronic
904307461 1:29599338-29599360 CCTGCCCTCAGCCCCCATGGTGG - Intergenic
904470616 1:30733799-30733821 CCAGGCCCCAGCCCCAGTGCTGG - Exonic
904587241 1:31587137-31587159 CCTGCCCGCGGCTCCCAGGCGGG - Exonic
904678978 1:32215735-32215757 CCAGCCTCCAGCTCTCAGCCAGG - Intronic
905537598 1:38735376-38735398 CCAGGCCCCAACTCCAATACTGG + Intergenic
905825286 1:41021965-41021987 TCAGGCCCCAGTTCCCATGCAGG + Exonic
905834539 1:41106238-41106260 CCAGGCCCCACCTCCAACGCTGG - Intronic
906191604 1:43902745-43902767 GCAGCCTCCAGCTCCGGTGCAGG + Intronic
906399024 1:45491183-45491205 CCCGCCCCCAACCCCCCTGCTGG - Intergenic
906949033 1:50319472-50319494 CCAGCCCCCAGCTGGCTGGCTGG - Intergenic
907290027 1:53407623-53407645 CCAGGCCCCACCTCCAATACTGG - Intergenic
907317914 1:53584284-53584306 TCTGCCCTCAGCCCCCATGCAGG + Intronic
907334873 1:53693500-53693522 CCAGCCACCACATCCCATCCTGG + Intronic
907424398 1:54370168-54370190 CCAGCCACCAGCTTCCAGGAAGG - Intronic
908395939 1:63725693-63725715 CCAGGCCCCACCTCCAATACTGG + Intergenic
908651909 1:66343021-66343043 CCATCACCCAGCACCCAGGCTGG - Intronic
908810908 1:67981622-67981644 CCAGCCCAAACCTCTCATGCTGG + Intergenic
909131420 1:71741985-71742007 CCAGGCCCCACCTCCAATACTGG + Intronic
909724139 1:78813256-78813278 CCAGACCCCACCTCCAATACTGG + Intergenic
910200717 1:84695649-84695671 CCAGGCCCCACCTCCAATACTGG + Intergenic
910357758 1:86378903-86378925 CCAGGCCCCAGCTCCAACACTGG - Intronic
911070703 1:93829851-93829873 CCAGGCCCCACTTCCAATGCTGG - Intronic
911708477 1:101041856-101041878 CCAGGCCCCACCTCCAATACTGG + Intergenic
912836373 1:112999998-113000020 CCAGCCCCCAGCTTCCAGGGAGG - Intergenic
913074219 1:115327811-115327833 CCTGCCCCCACCTCCCAAGCAGG - Intronic
915101262 1:153502552-153502574 CCAGGCCCCACCACCCATGTGGG + Intergenic
916281470 1:163055865-163055887 CCAGGCCCCACCTCCAATGCTGG + Intergenic
916758193 1:167793104-167793126 CCAGGCCTCACCTCCAATGCTGG - Intergenic
916823982 1:168426881-168426903 CCAGCCCCCAGATCCAGTCCTGG - Intergenic
916843189 1:168621464-168621486 TCAACCCCCAGCTCTCATCCAGG - Intergenic
916918077 1:169431680-169431702 CCAAACCCCAGCTCCCTAGCAGG + Intronic
918071292 1:181134992-181135014 CCATCCCCAGGCTCCCAAGCTGG - Intergenic
919026934 1:192184109-192184131 CCAGGCTCCACCTCCAATGCTGG + Intronic
920105878 1:203553149-203553171 CCAGGCCACAGCTATCATGCAGG + Intergenic
920229283 1:204459937-204459959 CCTGCCCCCAACTCCCAGGCAGG - Exonic
920253577 1:204638894-204638916 CCAGGCTCCTGCTCCCAGGCTGG + Intronic
920533310 1:206721052-206721074 CCAGGCCCCACCTCCCACACTGG - Intronic
920745699 1:208625964-208625986 ACAGGCACCAGCTCCCCTGCAGG + Intergenic
921096821 1:211893856-211893878 CGATCCCCCAGCTCCAAAGCTGG - Intergenic
922069091 1:222173740-222173762 CCAGCCCCCACCTCCAACACTGG + Intergenic
922616632 1:226964822-226964844 CCAGGTCCCGGCTCCCAGGCTGG + Intronic
922701516 1:227763863-227763885 CCAGGTCCCCGCTCCCAGGCAGG + Intronic
922758302 1:228108954-228108976 CCAGCCCCAGGCTCCTGTGCTGG - Exonic
922925261 1:229342597-229342619 CCCGCCCCCTGCTCCCGTCCGGG - Intronic
923504635 1:234594885-234594907 CCAGGCCCCACCTCCCACACTGG + Intergenic
924364298 1:243274305-243274327 CCAGGCCCCACCTCCAATGCTGG + Intronic
924404704 1:243730634-243730656 CCAGCCGGCGGCTCCCAGGCTGG - Intronic
924583962 1:245345582-245345604 CCAGGCCCCACCTCCCACGCTGG - Intronic
924732177 1:246722406-246722428 CCAGGCCCCACCTCCAATGCTGG + Intergenic
924824565 1:247525754-247525776 CCAGCCCCCAACCTCCATGGAGG - Intronic
1062963356 10:1589990-1590012 CCAGCCCACAGCTCACAGCCTGG - Intronic
1063067467 10:2623941-2623963 CCATTCCCCAGCAACCATGCTGG - Intergenic
1063267605 10:4471804-4471826 GCAGCCTCCACCTCCCAGGCTGG - Intergenic
1063449624 10:6142812-6142834 CCAGCTCCCAGCCCCCATCCTGG + Intergenic
1064404856 10:15052770-15052792 CCAGGCCCCAGGCCCCAGGCCGG + Intronic
1064569798 10:16680754-16680776 CCAGGCCTCACCTCCAATGCTGG + Intronic
1064747495 10:18492225-18492247 CCAGGCCCCACCTCCCACACTGG + Intronic
1065013949 10:21444282-21444304 CCAGGCCCCACCTCCAATACTGG - Intergenic
1065016794 10:21469666-21469688 CCAGGCCCCACCTCCAATACTGG - Intergenic
1065059881 10:21889342-21889364 CCAGACCCCACCTCCAATACTGG + Intronic
1065261303 10:23926205-23926227 CCAGCCCCCTCCACCCATCCCGG - Intronic
1065633113 10:27702355-27702377 CCACCCTGCACCTCCCATGCAGG - Intronic
1066295727 10:34052658-34052680 CCAGGCCCCACCTCCAATACTGG - Intergenic
1066343840 10:34562505-34562527 GCAGCACCGAGCTCACATGCAGG + Intronic
1066530657 10:36334921-36334943 CTAGCAGCCAGCTCCGATGCTGG - Intergenic
1066583182 10:36902651-36902673 CCAGGCCCCACCTCCAATACTGG + Intergenic
1066684024 10:37963553-37963575 CCAGTCCCCAACTCCCACACTGG - Intronic
1066996789 10:42571312-42571334 TCAGGCCCCACCTCCAATGCTGG - Intergenic
1067037389 10:42930641-42930663 CGAGCCCCCCACACCCATGCTGG - Intergenic
1067058120 10:43064235-43064257 ACAGGCCCCACTTCCCATGCTGG - Intergenic
1067478235 10:46579772-46579794 CCACACCCCAGCTCCCCTCCTGG + Intronic
1067616504 10:47762015-47762037 CCACACCCCAGCTCCCCTCCTGG - Intergenic
1068786996 10:60987564-60987586 CCATCCTCCATCTCCCATGTAGG + Intronic
1068852736 10:61762743-61762765 CCAGGTCACAGCTCCCATTCAGG - Intronic
1069296487 10:66851466-66851488 CCAGGCCCCACCTCCGATACTGG - Intronic
1069561579 10:69434746-69434768 CCAGGCCCCTCCTCCAATGCTGG + Intergenic
1069591778 10:69646384-69646406 CCAGCCCCCAGCCCCCAGCACGG - Intergenic
1069694436 10:70376548-70376570 CCTGCCGCCAGCCCCCAGGCTGG + Exonic
1069897217 10:71687275-71687297 CACACCCCCAGCTCCCATGCTGG - Intronic
1069950420 10:72014749-72014771 CCACCCCTCAGCTGCCAGGCCGG + Intergenic
1070393195 10:75989043-75989065 GCAGCCCTCATTTCCCATGCAGG + Intronic
1070751695 10:78967805-78967827 CCTGCCCACAGCCCACATGCAGG + Intergenic
1070768262 10:79068571-79068593 GCAGCCCCCAGCCCCCCTGCAGG - Intergenic
1070900300 10:80022641-80022663 GGGGCACCCAGCTCCCATGCTGG - Intergenic
1070902053 10:80038511-80038533 GGGGCACCCAGCTCCCATGCTGG - Intergenic
1070920077 10:80179074-80179096 CCTGGCCCCACCTCCAATGCTGG - Intronic
1071121777 10:82287142-82287164 CCAGGCCCCACCTCCAATACTGG - Intronic
1071338549 10:84621801-84621823 CCAGCCCCCACCACCAATACTGG - Intergenic
1071801022 10:89060468-89060490 CCAGGCCCCACCTCCAATGTTGG - Intergenic
1072223029 10:93343582-93343604 CCAGGCCCCACCTCCCAAGAGGG - Intronic
1072299017 10:94041147-94041169 CCAGCCCCCAACTCCCACCCTGG + Intronic
1072719548 10:97772069-97772091 CCTGGCCCCAGCTCCAAGGCGGG + Intergenic
1072739664 10:97901768-97901790 GCAGCCCCCAGGTCCTTTGCGGG - Intronic
1073180757 10:101581489-101581511 TCAGCCCCCAGCTCCATTCCAGG - Intronic
1073207408 10:101776255-101776277 CCAGGCCCCAGTTCCCAGCCGGG - Intronic
1073288555 10:102402384-102402406 CCTGCCCCCAGCCCCCTTCCCGG + Exonic
1073289850 10:102408207-102408229 ACTGCACCCAGCTCACATGCAGG - Intronic
1073847790 10:107578717-107578739 CCAGCCTACGTCTCCCATGCTGG + Intergenic
1074155119 10:110791717-110791739 CCAGGCCCCCGATCCCATGTGGG + Intronic
1075076798 10:119357399-119357421 CCTGACCCCCGCTCCCATGAGGG - Intronic
1075378177 10:121996470-121996492 CCAGGCCCCACTTCCAATGCTGG + Intronic
1075470739 10:122687536-122687558 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1075470756 10:122687584-122687606 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1075470772 10:122687632-122687654 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1075470789 10:122687680-122687702 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1075470806 10:122687728-122687750 CCAGGCCCCACCTCCAATGCTGG + Intergenic
1075470823 10:122687776-122687798 CCAGGCCCCACCTCCAATGCTGG + Intergenic
1076052403 10:127346231-127346253 CCAGCACACAGCTGCCCTGCTGG - Intronic
1076505504 10:130970473-130970495 ACAGTCCCGGGCTCCCATGCAGG + Intergenic
1076843133 10:133056372-133056394 CCAGGCCCCAGCACCTGTGCTGG + Intergenic
1077026166 11:441001-441023 CCAGCCCCTTCCTCCCATGCTGG - Intronic
1077071937 11:678791-678813 CCAGCGTGCAGCCCCCATGCAGG - Exonic
1077268822 11:1665705-1665727 GCAGCCCCCAGGGCCCCTGCTGG + Intergenic
1077271931 11:1685475-1685497 GCAGCCCCCAGGGCCCCTGCTGG - Intergenic
1077419522 11:2444101-2444123 CCACCCCCCAGCAGCCCTGCCGG + Intergenic
1077427150 11:2486850-2486872 CCAGGCCCCACCTCCAACGCTGG + Intronic
1077463460 11:2722367-2722389 CCAGCACTCAGCTCCCAGGATGG - Intronic
1077659541 11:4055283-4055305 TCAGTCCCCAGCTCCCTTCCTGG + Intronic
1078421606 11:11217257-11217279 CCAGCCCCCAGAGCCCATCCTGG - Intergenic
1078744644 11:14100021-14100043 CCAGGCCCCATCTCCAATACTGG + Intronic
1078896296 11:15600224-15600246 CCTGCCTCCAGCCCCCATCCAGG + Intergenic
1079101423 11:17544403-17544425 CCCGCCCCCAGCTCCGAGGGCGG - Intronic
1079135537 11:17774287-17774309 CCAGGCCCCAGCTTCCATGTGGG + Intronic
1079208097 11:18435270-18435292 CCAGGCCCCAGCTCCCACACTGG - Intronic
1079314774 11:19398381-19398403 CCAGGCCCCACCTCCAATACTGG + Intronic
1079383614 11:19959795-19959817 CCAGCCGACAGCTACCGTGCTGG + Intronic
1079554194 11:21739400-21739422 CCAGGCCCCAGCTCCAACACTGG + Intergenic
1080284800 11:30597799-30597821 CCACCCTCCAGCGACCATGCTGG + Intergenic
1080597920 11:33792025-33792047 CCAGGCCCCACCTCCAATGTTGG - Intergenic
1080878789 11:36300458-36300480 CTAGACCCCACCTCCAATGCTGG + Intronic
1081354106 11:42092048-42092070 CCAGCTCCCAGCTCAGACGCAGG + Intergenic
1081492444 11:43579059-43579081 CCGCCCCCCATCTCCCATGTAGG - Intronic
1081598390 11:44475130-44475152 CCTGCCCCCAGGTCCGAGGCAGG + Intergenic
1081640936 11:44753821-44753843 GCAGCTCCCACCTCTCATGCAGG + Intronic
1081668651 11:44931230-44931252 GCAGCCCCCAGGCCCCAGGCTGG - Exonic
1081756943 11:45551438-45551460 CCAGCCCACAGCTCCTAAGCAGG + Intergenic
1081862089 11:46339089-46339111 CCTGCCCCCAGCCCCTCTGCAGG - Intronic
1082862234 11:57867680-57867702 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1082988329 11:59186460-59186482 CCTGCTCCCAGCTCCCCAGCAGG - Intronic
1083680535 11:64349679-64349701 ATGGCCCCCAGCTCCCAGGCGGG - Intronic
1083841850 11:65309144-65309166 CCATCCCCCAGGTCCCATGGGGG + Intergenic
1084049746 11:66592052-66592074 CCAGCCTCCAGCCCTCACGCAGG + Exonic
1084233582 11:67771045-67771067 CCAGGCCCCAGCTCCAACACTGG - Intergenic
1084603226 11:70158840-70158862 CCAGCCCCCAGCCCCCACCGAGG - Intronic
1084686334 11:70698016-70698038 CCAGCCTCAACCTCCCCTGCAGG + Intronic
1084737865 11:71117494-71117516 CCGGCCACCAGCCCCCATCCTGG - Intronic
1084789012 11:71461835-71461857 CCAGGCCCCACCTCCAATGCTGG + Intronic
1084965790 11:72743842-72743864 CCAACCCCCAGCCCTCAGGCAGG + Intronic
1085416421 11:76321817-76321839 CCCTCCCCCAGCTCCCACCCTGG + Intergenic
1085904017 11:80738181-80738203 CCAGGCCCCACCTCCAATACTGG - Intergenic
1086059213 11:82683032-82683054 CCACCCCCCACTTCCCATACAGG - Intergenic
1087221103 11:95547167-95547189 CCAGGCCCCAGTTACCATTCAGG + Intergenic
1087394955 11:97585519-97585541 CCAGGCCCCAGCTCCAATATTGG - Intergenic
1088136490 11:106561947-106561969 CCAGGCCCCACCTCCAATACTGG - Intergenic
1088382199 11:109205892-109205914 CCAGCCCCCAGCACCCTGACAGG + Intergenic
1088453944 11:110014135-110014157 CCAGGCCCCACCTCCAATACTGG + Intergenic
1088617445 11:111645020-111645042 CCAACTCCCAGCTCTCATGGAGG + Intronic
1088954014 11:114599830-114599852 CCAGGCCCCAGCTCCAACACTGG + Intergenic
1089123929 11:116162765-116162787 CCAGCCCCCAGCCCCCAGCCCGG + Intergenic
1089327833 11:117669439-117669461 CCAGCCCAAGCCTCCCATGCTGG + Intronic
1089564324 11:119363160-119363182 ACAGGCACCAGCTCCCGTGCTGG - Intronic
1089638553 11:119832218-119832240 CCAGCCCCCATGTCCCCTGCTGG + Intergenic
1090554819 11:127862924-127862946 CCAGCCCCCAACCCCCCAGCAGG + Intergenic
1091744744 12:2983911-2983933 CCAGCCCCCATCTCCCAGTAAGG - Intronic
1091782497 12:3222813-3222835 CCACCCCCCAGGTCCCACCCTGG + Intronic
1091882413 12:3990523-3990545 CCTGCCCCCACCTCCCCTTCTGG - Intergenic
1092564702 12:9651669-9651691 CCAGACCCCACCTCCAACGCTGG + Intergenic
1094267914 12:28579969-28579991 CCAGGCCCCATCTCCCACACTGG - Intergenic
1094394910 12:29995257-29995279 CCAGGCCCCACCTCCAATGCTGG - Intergenic
1094408074 12:30140004-30140026 CCAGGCCCCAGCTCCAACACTGG - Intergenic
1094443796 12:30507834-30507856 CCAGTGCCCAGCCCCCATACTGG + Intergenic
1095752929 12:45730202-45730224 CCAGCCCCAAGCGCCCACTCCGG - Intronic
1096016642 12:48282264-48282286 CCAGCCCCCAGGTCACAGACTGG + Intergenic
1096346309 12:50850164-50850186 CCAGGCCCCACCTCCAATACTGG - Intronic
1096549636 12:52363674-52363696 CCAAACCCCAGCTCCCCTGCTGG - Intronic
1096553217 12:52387960-52387982 CCATCCTGCTGCTCCCATGCTGG + Intergenic
1096558370 12:52418306-52418328 CCAGCCCCCAGCCCCCCTGTTGG + Intergenic
1097075126 12:56387361-56387383 CCAGGCCCCAGCTCCAACACTGG + Intergenic
1097195560 12:57240806-57240828 CCCGTCCCCAGCTCCCATCTGGG - Intergenic
1097750389 12:63346065-63346087 CCAGGCCCCTGCTCCAATACTGG + Intergenic
1098369088 12:69738741-69738763 TCCGCCCCCAGGCCCCATGCCGG + Intronic
1098876585 12:75872122-75872144 CCAGCCCTCACTTCCCATGGAGG - Intergenic
1099967197 12:89461209-89461231 CCAGCCCACAGGTCACATGCTGG - Intronic
1101376006 12:104172216-104172238 CCCGCCCCCTGCTCCCCTCCAGG - Intergenic
1101612359 12:106303144-106303166 CCCGCTCCCCGCTCCCACGCGGG - Intronic
1101831736 12:108263179-108263201 CCAGCCTACAGCTGCCCTGCAGG - Intergenic
1102439085 12:112947971-112947993 CCATTCCCCAGGTCCCATGTGGG - Exonic
1102877417 12:116458936-116458958 CACGCCCCCGACTCCCATGCTGG + Intergenic
1103253256 12:119519220-119519242 CCAGCCCCCAGCCTCAAGGCCGG + Intronic
1103724175 12:122989671-122989693 CCAGCCCCCAGCTCCCTGTTAGG + Intronic
1103729789 12:123019883-123019905 CCACCTCCCAGCTCCCCTGCAGG - Intronic
1103918099 12:124386250-124386272 CCAGGCCCCACCTCTCCTGCTGG + Intronic
1103959488 12:124600045-124600067 CCAGGCCCCAGCTGCCAGGAGGG - Intergenic
1104174648 12:126318266-126318288 CCAGCCAGCTGCTGCCATGCGGG + Intergenic
1104381359 12:128310663-128310685 CCAGACCCCACCTCCAATACTGG + Intronic
1104421845 12:128642449-128642471 TCAGGCCCCACCTCCAATGCTGG - Intronic
1104843018 12:131833697-131833719 CCTGCCCCCAGGCCCCATGCAGG + Intronic
1104856626 12:131905237-131905259 CCAGCCCATAGCTCCTCTGCGGG + Intronic
1104871908 12:132005611-132005633 CCACTCCCCAACTCGCATGCAGG - Intronic
1105830498 13:24160199-24160221 CCAGCCCCCACCCCCCAGGGCGG - Intronic
1106474275 13:30084047-30084069 CCAGCCCCCAGCCCACATACTGG + Intergenic
1106947838 13:34848508-34848530 CCAGGCCCCACCTCCAATACTGG - Intergenic
1107673152 13:42767800-42767822 CCAGGCCCCACCTCCAATACTGG + Intergenic
1108100244 13:46946597-46946619 CCAACCCCCAGTTCCCATCATGG - Intergenic
1108188616 13:47913942-47913964 CCAGCCCCCAGCCCCCCAACAGG - Intergenic
1109218407 13:59616218-59616240 CCAGCCCCCATCTCCAATACTGG + Intergenic
1109915712 13:68983183-68983205 CCAGCCTCCAGCGCCCAAGGTGG - Intergenic
1111494688 13:89033114-89033136 CCAGGCCCCAGCTCCAACACTGG - Intergenic
1112025022 13:95403934-95403956 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1112107074 13:96252694-96252716 ACAGGCCCCACCTCCAATGCTGG - Intronic
1112240812 13:97679399-97679421 CAAGGCCCCTGCTGCCATGCTGG - Intergenic
1112696361 13:101953371-101953393 ACAGCTCCCAGATCCCCTGCTGG - Intronic
1112786905 13:102961284-102961306 CCAGGCCCCACCTCCAAAGCTGG + Intergenic
1113088697 13:106594744-106594766 CCAGTCCCCAGCCTCCAGGCCGG - Intergenic
1113476256 13:110583607-110583629 CCAGGCCCCACCTCCCACACTGG - Intergenic
1113572081 13:111365360-111365382 GCAGCCCCCACCCCCCATGTTGG - Intergenic
1113895116 13:113759309-113759331 CCAGCCCCGCGCTCACCTGCGGG - Exonic
1114537236 14:23430695-23430717 CAAGCCCCCGGCTCTCATGGAGG + Intronic
1115642234 14:35342043-35342065 CCAGCCAGCAGCTGCCTTGCTGG + Intergenic
1115753605 14:36513821-36513843 ACAGCTCCCAGTTCCCAGGCTGG + Exonic
1116767713 14:49092432-49092454 CCATCCCCCAGCTGCTGTGCTGG - Intergenic
1117497495 14:56319982-56320004 CCAGGCCCCACCTCCAATACTGG - Intergenic
1118302257 14:64626113-64626135 CCGGCTCCCAGCTCCCAGGCAGG - Intergenic
1118495346 14:66303435-66303457 CCAGGCCCCACCTCCAATGTTGG - Intergenic
1118734221 14:68690550-68690572 CCTGCCCGCAGCTCACAGGCTGG + Intronic
1118746186 14:68775208-68775230 CCAGCCCCCAGCCTACCTGCTGG + Intergenic
1118858435 14:69642642-69642664 CCCGCCCCCCGCCCCCCTGCTGG + Intronic
1118898810 14:69969597-69969619 ACAGGCCCCACCTCCCACGCTGG + Intronic
1119089198 14:71764850-71764872 CCAGCCCCCAGCACCTGTGAGGG - Intergenic
1119124992 14:72117255-72117277 CCAGCCCCCACCTCCAACGTTGG - Intronic
1119261340 14:73239866-73239888 CCCGCCCCCGACTCCCCTGCAGG - Intronic
1119561106 14:75590538-75590560 CCAGGCCCCACCTCCAATACTGG - Intronic
1121442223 14:93956490-93956512 CCAGCACTCAGGTCCCATGCTGG + Intronic
1121565098 14:94903504-94903526 CCAGCCCCCAGCCCTCAGGCAGG - Intergenic
1121950784 14:98169509-98169531 CATGCCCCCAACTCCCATTCTGG + Intergenic
1121961280 14:98262524-98262546 CCAGGCCCCACCTCCAATACTGG + Intergenic
1122276702 14:100594413-100594435 GCAGCCCCTAGATCCCTTGCAGG - Intergenic
1122658939 14:103281584-103281606 GCACCCCCCACCTCCCTTGCCGG - Intergenic
1122809537 14:104281200-104281222 CCAGCCCCGCCATCCCATGCTGG - Intergenic
1122889975 14:104727720-104727742 CCTGCCCCCTGTTCCCAGGCTGG + Intronic
1122932606 14:104941635-104941657 CCAGGCCCCAGGATCCATGCTGG - Exonic
1122957148 14:105076160-105076182 CCAGCGCTCAGCACCCATGCTGG + Intergenic
1123008552 14:105336072-105336094 CAGGCCCCCAGCTCCCACGCGGG + Intronic
1123071204 14:105643352-105643374 CAAGACCACACCTCCCATGCTGG - Intergenic
1124036310 15:26056827-26056849 CCAGCCCGCAGCTGCAATGTGGG + Intergenic
1124051108 15:26198229-26198251 CCAGCCCCCACCTCCAACACTGG + Intergenic
1124616870 15:31248471-31248493 CCAGCCCCCAATTCCCATGCTGG - Intergenic
1124626122 15:31308428-31308450 CCCGCCCACAGCTCTCCTGCTGG - Intergenic
1124716822 15:32071544-32071566 CCAGGCCCCACCTCCAATACTGG - Intronic
1125274846 15:37979080-37979102 CCAGGCCCCACCTCCAATACTGG + Intergenic
1125371590 15:38983778-38983800 CCCGCCCCCCGCCCCCATCCAGG - Intergenic
1125435996 15:39645799-39645821 CCAGTCCCCAGCTCCAATCTCGG + Intronic
1125476230 15:40049887-40049909 CCAGCCCCCACCTCCTCTGAAGG - Intergenic
1125685709 15:41562034-41562056 CCAGGCCCCAGCTCCCATTCAGG - Intronic
1125988412 15:44079403-44079425 CCAGCACCCAGCTCAATTGCTGG - Intronic
1128804718 15:70522224-70522246 CCGGCCCCCAGTTACCATGGAGG + Intergenic
1129093247 15:73174363-73174385 CCAGCCCACAGCACCCCAGCAGG - Intronic
1129298544 15:74612794-74612816 GCTGCCCCCACCTCCCATACTGG + Intronic
1129424518 15:75454343-75454365 CCGCCCCTCAGCTCCCCTGCAGG + Intronic
1129524301 15:76204231-76204253 CCAGCCCACTGTGCCCATGCTGG + Exonic
1129789047 15:78328577-78328599 CCAGCTGCCAGCTCCCAACCAGG + Intergenic
1129812650 15:78523444-78523466 CCAGGCCCCACCTCCAATACTGG + Intronic
1129844093 15:78760345-78760367 ACAGCCCCCAGCTGCCACCCGGG + Intronic
1129914316 15:79254893-79254915 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1130128923 15:81119777-81119799 ACAGGCCCCAGCCCCCATGGTGG + Intronic
1130382233 15:83380450-83380472 CCAACCCCTACCTCCCATACTGG - Intergenic
1131818366 15:96246202-96246224 GCAGCCCCCAGCTCGCCAGCAGG + Intergenic
1132554873 16:568032-568054 CCTGGCCCCAGCCTCCATGCTGG + Exonic
1132644471 16:992448-992470 CCAGGCCCCTGCCCGCATGCAGG - Intergenic
1132698462 16:1212264-1212286 CCAAGGCCCAGCCCCCATGCAGG - Intronic
1132731144 16:1362567-1362589 GCAGCACCCAGCTCCCAGCCAGG - Intronic
1132807403 16:1781542-1781564 CCAGCCCTGAGCTTCCAGGCTGG + Intronic
1132830668 16:1926522-1926544 CCATCCCTCATCTCCCAGGCTGG + Intergenic
1133020546 16:2964992-2965014 CCAGCCCCCAGCGGCCGTGGGGG - Exonic
1133049464 16:3108863-3108885 CCAGCCACCAGCTTACATACGGG - Intergenic
1133462204 16:5996734-5996756 ACAGCTCACAGCTCCCCTGCAGG + Intergenic
1133749340 16:8712644-8712666 CCAGCCCCCAGCCCCCAAATCGG - Intronic
1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG + Intergenic
1134321393 16:13167532-13167554 CCAGGCCCCACCTCCAATACTGG - Intronic
1134584115 16:15396216-15396238 CCACCCCCCAGGTCCCCTCCCGG - Intronic
1135477027 16:22785841-22785863 CCAGGCCCCACCTCCAATACTGG + Intergenic
1135503033 16:23013610-23013632 CCAGGCCCCAACTCCAATACTGG - Intergenic
1136009001 16:27350229-27350251 CCAGTTCCCAGCTCCCTTCCAGG + Intronic
1136393121 16:29977768-29977790 CCGGCCCCCAGCTGGCATGGTGG - Exonic
1138638595 16:58364295-58364317 CCTGCCACCAGCATCCATGCAGG - Intronic
1139156017 16:64443382-64443404 CCAGGCCCCACCTCCAGTGCTGG + Intergenic
1139442178 16:66973879-66973901 CCAGCTCCCAGCCCCAGTGCCGG + Exonic
1139570104 16:67806459-67806481 CCCGCCCCCAGCGCCCCCGCCGG + Exonic
1140704508 16:77614115-77614137 CCAGGCCCCACCTCCAACGCTGG - Intergenic
1141318634 16:82985729-82985751 CCAGGTCCCACCTCCAATGCTGG - Intronic
1141344410 16:83231817-83231839 CCAGGCCCCACCTCCAGTGCTGG - Intronic
1141412451 16:83844925-83844947 CCAGCCCCCAGTTCACACGATGG - Intergenic
1141623369 16:85248871-85248893 CCAGTGCCCAGGGCCCATGCAGG - Intergenic
1141928226 16:87183174-87183196 CCAGGCCCCATCTCCAATACTGG - Intronic
1142145171 16:88489911-88489933 TCACCCACCAGCTCCCATGACGG - Intronic
1142250440 16:88989503-88989525 CCGGCTCCCAGCTCCCACGGAGG - Intergenic
1142427124 16:90007152-90007174 TCAGCCCCCAGCTCACCTCCAGG - Intronic
1142757732 17:2025610-2025632 CCTGCCCCCAGTCCCCAAGCCGG + Intergenic
1143030311 17:3963985-3964007 CCAGCCCCCAGCCCCGGCGCCGG + Intronic
1143120097 17:4600983-4601005 CCATCCTCCAGCTCCCTTACAGG + Intronic
1143265321 17:5632508-5632530 CCATCCCCCAGCTCCCTCACTGG - Intergenic
1143417119 17:6758331-6758353 CCAGACCCCATCTCACCTGCAGG - Intronic
1143417163 17:6758619-6758641 CCAGACCCCATCTCACCTGCAGG - Intronic
1143417175 17:6758664-6758686 CCAGACCCCATCTCTCCTGCAGG - Intronic
1143417200 17:6758762-6758784 CCAGACCCCATCTCACCTGCAGG - Intronic
1143417210 17:6758810-6758832 CCAGACCCCATCTCACCTGCAGG - Intronic
1143417247 17:6758953-6758975 CCAGACCCCATCTCACCTGCAGG - Intronic
1144009922 17:11137348-11137370 CCCTCCTTCAGCTCCCATGCTGG + Intergenic
1144202372 17:12953106-12953128 GCCTCCCCCAGCTCCCATGTAGG - Intronic
1144401540 17:14907807-14907829 CCAGGCCCCACCTCCAATACTGG + Intergenic
1144638976 17:16927231-16927253 ACAGCCCCCAGCTCCCACCCCGG - Intergenic
1144946784 17:18973424-18973446 CCAGGCTACAGCTCCAATGCTGG - Intronic
1145397051 17:22504509-22504531 CCAGCCCAGAGGTGCCATGCTGG + Intergenic
1145757547 17:27403698-27403720 CCAGCCCACAGCTTCCTTACTGG + Intergenic
1145812811 17:27774671-27774693 TCAGCCCACAGGTCCCATGGGGG + Intronic
1146256065 17:31392066-31392088 CCCTCCCCCAGCTCCCCCGCCGG + Intronic
1146256269 17:31392794-31392816 ACAGTCCCCAGTCCCCATGCCGG - Intronic
1146477516 17:33174910-33174932 CCAGCCACCAGCTACCCTACTGG + Intronic
1146680715 17:34805778-34805800 AAAGGCCCCTGCTCCCATGCAGG + Intergenic
1147872642 17:43598363-43598385 CCCTCCCACAGCTCACATGCAGG - Intergenic
1147911011 17:43856289-43856311 GCAGCTCCCGGCTCCCGTGCTGG + Intronic
1147968425 17:44206780-44206802 CCTGCCTCCAGTTCCAATGCAGG + Exonic
1148197985 17:45728586-45728608 CCAGCCCCAAGCTCCACAGCTGG - Intergenic
1148677264 17:49452586-49452608 CCAGCCCCCATATCCCATCTTGG - Intronic
1150219172 17:63486469-63486491 CCAGCCCTCAGCTCCCACTTGGG + Intronic
1151454487 17:74217902-74217924 CAGGCCCCCAGCTCCCACACTGG - Intronic
1151526193 17:74670454-74670476 TCAGCCTCCAGTTCCCATGGTGG + Intergenic
1151715883 17:75830865-75830887 CCCGACCCCACCCCCCATGCGGG + Intronic
1151801527 17:76382467-76382489 CCGGGCCCCAGCTCCCCTCCTGG - Intronic
1152601225 17:81263241-81263263 CCAGCCCAAAGATTCCATGCAGG - Intronic
1152629107 17:81401838-81401860 CCATGCCCCAGCTCACATCCTGG + Intronic
1152676774 17:81645300-81645322 CCTGCCCGCAGACCCCATGCTGG + Exonic
1152764447 17:82128425-82128447 CCAGGCCCCGGCTTCCCTGCTGG + Intronic
1152776113 17:82203049-82203071 CCAGGCCCCAGCTCCCCCGTTGG - Intronic
1153172861 18:2336148-2336170 CCAGCCACCAGCTACCTTACTGG + Intergenic
1154366618 18:13716329-13716351 AGAGCCCCCAGCTCCAATGATGG + Intronic
1155390015 18:25325471-25325493 CCTGCCCCCAGCACCACTGCAGG + Intronic
1155443257 18:25884197-25884219 CCAGCAATCAGCTCCCCTGCAGG + Intergenic
1155898219 18:31355141-31355163 ACCGCTCCCAGCACCCATGCTGG - Exonic
1157198916 18:45642594-45642616 TCAGGACCCAGCTCCCATGGGGG + Intronic
1157522982 18:48357924-48357946 CCAGCCCTCACCTCCAACGCTGG - Intronic
1157560098 18:48639711-48639733 CCAGCCCCAAACGCCCATCCAGG - Intronic
1157600768 18:48891930-48891952 CCTGCCCCCTCCTCCCATGCGGG - Intergenic
1157806955 18:50665374-50665396 CCAGCCCCCAGCTCTGTTGCAGG - Intronic
1157878441 18:51295384-51295406 CCAGGCCCCACCTCCAATGCTGG + Intergenic
1157885774 18:51364942-51364964 CCAGCCCCCAACCCCCATGATGG + Intergenic
1158863293 18:61614209-61614231 CCAGACCCCACCTCCAATGTTGG - Intergenic
1159996987 18:74974674-74974696 CCATCCCCCAACTTCCATGTGGG - Intronic
1160010327 18:75102442-75102464 CCAGCCCCCACCTCCAACACTGG + Intergenic
1160344371 18:78120763-78120785 CCAGGCCCCACCTCCAATGACGG - Intergenic
1160662327 19:306848-306870 CCAGCCACCAGCTCCCCTCAGGG - Intronic
1160932386 19:1576906-1576928 CCAGCCCACTGCCTCCATGCGGG + Exonic
1161260558 19:3335546-3335568 CAACCCCCCAGCTCCCAGCCTGG - Intergenic
1161348586 19:3779786-3779808 CCACCCCCCAGCTGTCCTGCAGG - Exonic
1161424921 19:4198253-4198275 CCAGCCCCCAGCCCCCTACCTGG + Intronic
1161570065 19:5025608-5025630 CCAGCCCCCAGGGCCCACCCTGG + Intronic
1161653597 19:5499412-5499434 CCACCCCCCAGCCCCATTGCTGG - Intergenic
1162031990 19:7921521-7921543 ACAGCCCCCAGCCCCCATAGAGG + Exonic
1162133997 19:8544207-8544229 CCACCCTCCAGCACCCAGGCTGG - Intronic
1162315641 19:9936568-9936590 CCCGCCCCCAGCTCCTCTTCGGG + Intergenic
1162667912 19:12230664-12230686 TCTGCCCCCAGCACCCATCCTGG + Intronic
1162739362 19:12765325-12765347 CCATCCCACAGCTCCCAAGCTGG + Intronic
1163513633 19:17750033-17750055 CAAGACCCGAGCTCCCATCCTGG - Intronic
1164767163 19:30780964-30780986 CCAGGCCCCTGCTCCCATCTAGG + Intergenic
1164823014 19:31264594-31264616 CCAGCCACCTGCTGTCATGCAGG + Intergenic
1164835892 19:31354843-31354865 CCCACCCCCAGCTCCCATCCAGG - Intergenic
1164911180 19:32013205-32013227 TCAGCCCCCAGCTACCACTCGGG + Intergenic
1165004787 19:32795965-32795987 CCAGCCCCCACCTCCAACACTGG + Intronic
1165278176 19:34772835-34772857 CCAGCCCCCTGGGCCCATGGCGG - Exonic
1165466787 19:35979342-35979364 CCAGCCATCAGCTCACAGGCAGG - Intergenic
1165940501 19:39412789-39412811 CCAGACCCCGGCGCCCAGGCTGG + Exonic
1166181414 19:41111893-41111915 GCAGCCCCCACCACCCATGAAGG + Intergenic
1166205305 19:41265203-41265225 CCACCCCCCAGCCCACACGCTGG - Intronic
1166299947 19:41907791-41907813 CCCGCCCCCAGCCCCCACCCAGG - Intronic
1166364724 19:42272687-42272709 CCTGGCCCCAGCTCCCAGCCAGG + Intronic
1166510294 19:43403427-43403449 CCAGCCCCCAACTCCAAGACAGG - Intronic
1166670317 19:44705889-44705911 CCACCCCCCAGTCCCCATGGAGG + Intronic
1166901398 19:46066793-46066815 CCAGGCCCCACCTCCAATACTGG + Intronic
1167473956 19:49689707-49689729 CCAGTCCCCACTTCCCAGGCGGG - Exonic
1167614473 19:50524822-50524844 CCAGCCAGCAGCCCCGATGCTGG + Intronic
1168038285 19:53737896-53737918 CCAGCCTCCTGCTTCCATCCAGG - Intergenic
1168041952 19:53765852-53765874 CCAGCCTCCTGCTTCCATCCAGG - Intergenic
1168267280 19:55229852-55229874 CCAGCTCCCTCCTCCCAGGCTGG - Exonic
1168513953 19:56995011-56995033 CCAGCCCTCAGCTCGCACCCTGG - Intergenic
1168516537 19:57013961-57013983 CCAGGCCCCACCTCCAATACTGG - Intergenic
1202713171 1_KI270714v1_random:28378-28400 TCACCCCCCAGCTCCCATGGAGG + Intergenic
925051907 2:821938-821960 TCAGACCCCAGCTTCCATCCCGG + Intergenic
925058290 2:872025-872047 CCAGGGCCCAGCTCCCCTCCTGG + Intergenic
925449954 2:3960620-3960642 CCTGCCCACACCTCCCCTGCGGG + Intergenic
925716122 2:6785856-6785878 CCAGGCCCCACCTCCAATACTGG - Intergenic
925838120 2:7965453-7965475 CCGGCCCCCAGCCCACATGCTGG - Intergenic
925998126 2:9308416-9308438 CCAGGCCCCAGCTCCAACACTGG + Intronic
926006558 2:9377570-9377592 CCAGCCTTCAGCTGCCAGGCAGG - Intronic
926233448 2:11022077-11022099 CCAGGCCTCACCTCCAATGCTGG + Intergenic
926622047 2:15055495-15055517 CCAGCCCCCCGCCCCCCAGCTGG - Intergenic
926704263 2:15825738-15825760 CCAGCCCCCAGCCCCTCTCCAGG - Intergenic
926956634 2:18308915-18308937 CCAGGCCCCAGCTCCAGTACTGG - Intronic
927088860 2:19695158-19695180 CCAGCCCCCAGCTCCAGGTCTGG - Intergenic
927127955 2:20030510-20030532 CCAGGCACCACCTCCAATGCTGG + Intergenic
927231314 2:20826691-20826713 CCAGGCCCCATCTCCAATACTGG - Intergenic
927453846 2:23232361-23232383 CCAGGCCCCCTCTACCATGCTGG - Intergenic
928125433 2:28612242-28612264 TCAGCCCCCAGCTCAGATACTGG - Intronic
928332100 2:30365494-30365516 CCAGGCCCCACCTCCGATACTGG - Intergenic
928378628 2:30799564-30799586 CCTGCCCCCAGCTTCAAAGCTGG + Intronic
928407875 2:31028665-31028687 TGAGCCTCCAACTCCCATGCTGG + Intronic
928483021 2:31702820-31702842 CCAGGCCCCACCTCCAATACTGG - Intergenic
928676234 2:33654490-33654512 CAAGCCCCCAGATACAATGCAGG - Intergenic
928883990 2:36127823-36127845 CCAGCCCCCACCTCCCATTTGGG + Intergenic
929121401 2:38486933-38486955 CCAGCCACTTGCTGCCATGCGGG + Intergenic
929188731 2:39120789-39120811 CCAGCCGCCAGCTCCGCCGCGGG - Intronic
929531468 2:42755709-42755731 CCAGCCACCCGCTCCCTTTCTGG + Exonic
929806565 2:45151412-45151434 CCAGGCCCCAGCTCCAACACTGG - Intergenic
930202788 2:48560783-48560805 CCAGGCCCCAGCATCCATGCTGG + Intronic
930256291 2:49096734-49096756 CCAGGCCCCATCTCCAATACTGG - Intronic
930724300 2:54667524-54667546 CCAACTCCCATATCCCATGCAGG - Intronic
931289644 2:60861450-60861472 CCAGCCCTCATTACCCATGCTGG + Intergenic
931966105 2:67536676-67536698 CCAGGCCCCACCTCCAATACTGG - Intergenic
933370859 2:81413565-81413587 CCAGGCCCCACCTCCAATACTGG + Intergenic
933705999 2:85290892-85290914 ACAGCTCCCAGCTCCCATCCTGG - Intronic
934692036 2:96369052-96369074 CCAGCCCGCACCTCCTCTGCAGG - Exonic
935541124 2:104350616-104350638 CCAGTCCCCAGCTCTCTTGATGG - Intergenic
936158780 2:110068851-110068873 CCAGCCCACAGCTCACAGGGTGG - Intergenic
936185880 2:110302481-110302503 CCAGCCCACAGCTCACAGGGTGG + Intergenic
936703391 2:115040622-115040644 CCAGGCCCCACCTCCAATGCTGG - Intronic
936760041 2:115766936-115766958 CCAGGCCCCAGCTCCAACACTGG + Intronic
937149892 2:119679146-119679168 CCCGCCCCCAGATCCCCGGCCGG + Exonic
937247859 2:120505066-120505088 GCAGCCCCCAGGCTCCATGCAGG - Intergenic
937248669 2:120510173-120510195 CCAGCCCACAGCCCCCATGGAGG - Intergenic
937604919 2:123788080-123788102 CCAGGCCCCACCTCCAATACTGG - Intergenic
937972839 2:127564042-127564064 CCAGCCCAGAGCTCCCAAGGTGG - Intronic
938074645 2:128325240-128325262 CTAGCCCCCAGCCCCCAGCCCGG + Intergenic
938129988 2:128707012-128707034 CCAGACCCCACCTCCAATACTGG + Intergenic
938263658 2:129911750-129911772 CCAGGCCCCAGCCTCCCTGCCGG + Intergenic
938383378 2:130848871-130848893 CCAGGCACCAGCCCCCATTCTGG + Intronic
938590906 2:132735256-132735278 CCAGCCTCCAGCTCCAACACTGG - Intronic
940962450 2:159800432-159800454 CCAGAGCCCAGCTCCTCTGCTGG + Intronic
941108267 2:161387473-161387495 ACAGCCATCAGCTCACATGCTGG + Intronic
942364712 2:175212755-175212777 CCAGGCCCCACCTCCAATGTTGG - Intergenic
943428653 2:187769942-187769964 CCTGGCCCCAGCCCCAATGCTGG - Intergenic
944032445 2:195252048-195252070 CCAGACCCCACCTCCAATGCTGG - Intergenic
944577936 2:201107829-201107851 ACAGCCCCAACCTCCCAGGCGGG + Intergenic
944775837 2:202963529-202963551 CCATCCCCCATCCCCCATCCTGG - Intronic
944893316 2:204139608-204139630 CCAGGCCCCACCTCCCACGTTGG - Intergenic
945307616 2:208273635-208273657 CCAGCCCTCAGCTCCCTTCGAGG + Exonic
946107175 2:217381231-217381253 CCAGACCCCACCTCCAGTGCTGG + Intronic
946300467 2:218820889-218820911 CCCGCCCCAAGTTCACATGCAGG + Intergenic
946398020 2:219453098-219453120 TCAGCTCCCAGCTCCCCTGAGGG + Intronic
947019680 2:225661338-225661360 CTAGCACCCAGCTCACCTGCTGG + Intergenic
947637975 2:231689718-231689740 CCAACCCCCCGCCCCCCTGCTGG + Intergenic
948002218 2:234577578-234577600 CCAGGCCCCACCTCCAATACTGG + Intergenic
948092798 2:235308743-235308765 CCTGCCCTAAGTTCCCATGCAGG - Intergenic
948208495 2:236175746-236175768 CCAGCCCCCAGCTCCTCTTCTGG - Intergenic
948574413 2:238940567-238940589 CCAGCCAACAGCTTCCAGGCAGG + Intergenic
948689860 2:239695170-239695192 GCAGACCACAGCTCCAATGCTGG - Intergenic
948888214 2:240894330-240894352 CCAGTCCCCAGTTCCCTTCCAGG + Intronic
949067561 2:242002576-242002598 CCAGGCCCCACCTCCAACGCTGG - Intergenic
1168829073 20:834442-834464 CCAGCCCCCAGAGCCGCTGCTGG + Intronic
1168852930 20:989068-989090 CCGGCCCCCATCTCCCAAGCTGG + Intronic
1169072625 20:2742696-2742718 CCTGCCCCCTGCCCCCATCCTGG + Intronic
1169269358 20:4187392-4187414 ACAGCCCTCAGGTCCCCTGCTGG - Exonic
1169421606 20:5465159-5465181 CCAGCCCACAGCTCCTGGGCTGG - Intergenic
1169681040 20:8214244-8214266 CCAGGCCCCACCTCCAATACTGG - Intronic
1170590034 20:17764928-17764950 CCAGGCCCCAGCTCCAACACTGG + Intergenic
1170599603 20:17831254-17831276 CTAGCCCCCAGCCCCAGTGCGGG - Intergenic
1170685069 20:18562449-18562471 CCAGGCCCCACCTCCAATCCTGG - Intergenic
1170692759 20:18629954-18629976 CCAGGCCCCTCCTCCAATGCTGG + Intronic
1170922487 20:20691852-20691874 CCAGGCCCCACCTCCAATACTGG - Intronic
1171010047 20:21504555-21504577 CCAGTGCCCAGGTCCCATCCTGG - Intergenic
1171104328 20:22418054-22418076 CCAGGCCCCAGCTCCAACACTGG + Intergenic
1172005807 20:31818678-31818700 CCAGCCCCCTTCTTCCATGTGGG + Intergenic
1172084272 20:32367266-32367288 CCAGCCTCCGCCTCCCAAGCTGG - Intronic
1172298682 20:33832371-33832393 CCACCCGCCAGGTCCCAGGCTGG - Intronic
1172390657 20:34562771-34562793 CCTGCCCCCAGCTGCCCAGCTGG + Intronic
1172441736 20:34970977-34970999 CCAGACCCCAGCACCCACTCTGG - Intergenic
1173009003 20:39164289-39164311 CCAGGCCCCATCTCCAATGTTGG - Intergenic
1173351644 20:42251028-42251050 GCAGCCCCCATTTCCCAGGCTGG + Intronic
1173842680 20:46168327-46168349 CCAGCTCCCAACTCCAAGGCTGG - Intergenic
1173864455 20:46305470-46305492 CCAGCCCCTAGCACCCTTCCTGG + Intronic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1174451750 20:50624886-50624908 CCTGCCCCCAGCCTCCAGGCGGG + Intronic
1174548126 20:51341854-51341876 CCACCCCCCTGCTCCCACCCCGG + Intergenic
1174554759 20:51386174-51386196 CCAGCAGCCAGGACCCATGCAGG + Intergenic
1174648468 20:52105089-52105111 CCGGCCCCCAGCCCCCGGGCGGG + Intronic
1174665965 20:52258114-52258136 CCAGACCCCACCTCCAACGCTGG - Intergenic
1174912192 20:54619295-54619317 CCAGCTGCCAGCTGCCTTGCTGG + Intronic
1174949668 20:55030032-55030054 CCAGGCCCCACCTCCAATACTGG + Intergenic
1175324234 20:58111365-58111387 CCAGCCCCCGGCTTCAAAGCAGG + Intergenic
1175448483 20:59042804-59042826 CCCGCCCCCAGCACCCCAGCCGG + Exonic
1175625321 20:60484497-60484519 CCAGCCCTCAGCTCTCCTGATGG - Intergenic
1175919651 20:62444752-62444774 CCAGCCACCAGTCCCCAGGCTGG + Intergenic
1176246559 20:64100027-64100049 CCAGGCCCCACCCCTCATGCTGG - Exonic
1176421281 21:6518137-6518159 CCAGGCCCCACCTCCAATGTTGG - Intergenic
1178303856 21:31474201-31474223 CCAGGCCCCACCTCCAATACTGG + Intronic
1179311746 21:40202170-40202192 CCACCCCCCAGCTCCCACACAGG - Intronic
1179615416 21:42580191-42580213 CCAGCATCCAGCACCCCTGCAGG + Intronic
1179696771 21:43126452-43126474 CCAGGCCCCACCTCCAATGTTGG - Intergenic
1180001121 21:44996008-44996030 CAAGGCCCCAGCTCCAGTGCAGG + Intergenic
1180156014 21:45977717-45977739 CCACCCCCAAGCCCCCATCCAGG - Intergenic
1180618635 22:17145357-17145379 CCAGCTACCAGGTCCTATGCTGG + Intronic
1180648368 22:17358540-17358562 ACAGCCCCCAGCTCTGATGCAGG + Intergenic
1180840495 22:18956820-18956842 CCAGCCCCCTCCTGCCATGTGGG + Intergenic
1181031620 22:20150904-20150926 CCAGCCTCCAGCAGCCATGGAGG - Intergenic
1181060993 22:20281954-20281976 CCAGCCCCCTGCTGCCATGTGGG - Intronic
1181061562 22:20284413-20284435 CCAGCACTCAGCTCCCAGCCTGG + Intergenic
1181419176 22:22785959-22785981 CCAGCCCGCATCTCCCACGCTGG - Intronic
1181785182 22:25221657-25221679 CCAGCCCATAGCTGGCATGCTGG + Intronic
1182052157 22:27321633-27321655 CCATCCCTCAGCTCCCAGGGAGG + Intergenic
1182766259 22:32760225-32760247 CCAACAGCCAGCACCCATGCAGG + Intronic
1183011852 22:34953120-34953142 CCAGGCCCCACCTCCAATGCTGG + Intergenic
1183036867 22:35147224-35147246 ACTGCCCCCAGCTCTCATGCTGG + Intergenic
1183350955 22:37334645-37334667 CCAGCCCGGAGCGCCCAGGCGGG - Intergenic
1183780458 22:39995587-39995609 CCGGGCCCCACCTCCCAGGCAGG + Intronic
1183831319 22:40419650-40419672 CCAGCCCCCAGCCCCCAGCATGG + Intronic
1184096151 22:42317629-42317651 CCAGCCCCCAGCGGGAATGCAGG - Intronic
1184102354 22:42347483-42347505 CCAGCCCCCAGATGACATCCTGG - Intergenic
1184165692 22:42726094-42726116 CCTGTCCCCAGCTCCAAGGCGGG + Intergenic
1184176388 22:42791880-42791902 CCAGCCCCCGGCCCCCAGCCTGG - Intergenic
1184482366 22:44755301-44755323 CCAGACACCAGCTCCCATGTGGG - Intronic
1184694838 22:46133489-46133511 CCAGCCCACAGCTCCAAGGAGGG + Intergenic
1184932804 22:47693637-47693659 CCAGCCCCCAGCCCCTTTGCGGG + Intergenic
1185033849 22:48460630-48460652 CCAGCCCCCGGTTCCCTTCCTGG - Intergenic
949612142 3:5714037-5714059 CCAGGCCCCACCTCCAATACTGG - Intergenic
949772833 3:7597347-7597369 CCAGGCCCCATCTCCCACACTGG + Intronic
949951935 3:9236432-9236454 CCAGCCCCCACCTCCAACACTGG - Intronic
950165942 3:10799052-10799074 CCAGTCCCCAGCTCCTAGGCAGG - Intergenic
950581574 3:13865788-13865810 CCAGGCCCCAGGACACATGCTGG + Intronic
950912264 3:16606497-16606519 CCAGCCCCCATATCCCGGGCAGG - Intronic
951171293 3:19544804-19544826 CCAGCCCCCAACTCCCAGACAGG - Intergenic
951479109 3:23140933-23140955 CCAGCCCCCACCTCCCCAACAGG - Intergenic
951548354 3:23851874-23851896 CCAGGCCCCACCTCCAATGCTGG - Intronic
952386194 3:32843239-32843261 CCCACCCCCTGCTACCATGCAGG - Intronic
953230283 3:41058505-41058527 CCAGTCCCCACCTCCTACGCTGG + Intergenic
953912020 3:46898096-46898118 CCAGCTCCCAGCTGCCATTGCGG - Exonic
954371076 3:50169848-50169870 CCAGGCCCCAGCTCCCTTAAGGG - Intronic
954412777 3:50378236-50378258 CCAGCCCCTGGCTTCCCTGCAGG - Intronic
954685354 3:52367198-52367220 CCGGGCCCCTGCTCCCAGGCCGG + Intronic
954689106 3:52386452-52386474 CCAGCCCCCAGGGCCCAAGTAGG + Intronic
954703546 3:52465784-52465806 CCAGCCTCCAGCTCACAGGCAGG - Intronic
955051649 3:55416503-55416525 CCAGCTCCCAGCTCCAGTTCAGG + Intergenic
955551332 3:60088253-60088275 CCAGGCCCCACCTCCAATACTGG + Intronic
955950652 3:64239235-64239257 CCAGCCCCCCGCCCCCCAGCAGG - Intronic
956295542 3:67709363-67709385 CCAGCTCCCCACTCCCATGGAGG - Intergenic
957609737 3:82451694-82451716 CCAGGCCCCACCTCCAATGTTGG - Intergenic
959972834 3:112426541-112426563 CCAGGCCCCACCTCCAATGTTGG + Intergenic
960011631 3:112840537-112840559 CGAGACCCCACCTCCCATACTGG + Intronic
960801606 3:121545770-121545792 CCAGCCCCCAGTTCCTCTCCGGG - Exonic
961353274 3:126317145-126317167 CCAGCCCCCAGGGCACAGGCAGG - Intergenic
961362419 3:126376219-126376241 CCAGCCCCCTGCTCAGAGGCCGG + Intergenic
961444452 3:126972637-126972659 TGAGCCCCCAGCTGCCATGGTGG + Intergenic
961452500 3:127008736-127008758 TCAGCCCCCAGCCCCCAGCCTGG - Intronic
961452734 3:127009684-127009706 TCCGCCCCCTGCCCCCATGCTGG + Intronic
961561233 3:127731750-127731772 CCTGCCCCGTGCTCCCCTGCAGG + Intronic
961883164 3:130077401-130077423 CCAGGCCCCAGCTCCAACACTGG - Intergenic
962441830 3:135427142-135427164 CCAGGCCCCACCTCCAATGTTGG - Intergenic
962702688 3:138014559-138014581 CTATCCCCCAGTTCCCATGGTGG - Intronic
962826562 3:139104871-139104893 CCAGGCCCCAGCTCCCAGAGGGG - Intronic
963450944 3:145481318-145481340 CTAGCCCCCAGCTCCCTGACAGG - Intergenic
964445490 3:156753257-156753279 CCAGGCCTCACCTCCAATGCTGG - Intergenic
965030752 3:163363794-163363816 CCAGGCCCCACCTCCAATACTGG + Intergenic
965324335 3:167283755-167283777 CCTGCCCCAGGCTCCCAAGCTGG + Intronic
965341907 3:167501995-167502017 CCAGGCCCCATCTCCAATGCTGG - Intronic
965624191 3:170670599-170670621 CCAATCTCCAGCTCCCATGATGG - Intronic
965938267 3:174143142-174143164 CCAGGCCCCACCTCCAATACTGG + Intronic
968077591 3:195825016-195825038 GCATCCCCCAGCTCGCGTGCTGG + Intergenic
968598226 4:1496209-1496231 CCAGCCTCCAGCACCCAGGCTGG - Intergenic
969094181 4:4719665-4719687 CCAGGCCCCACCTCCAATACTGG + Intergenic
969184332 4:5464225-5464247 CCAGGCCCCACCTCCCAAACTGG + Intronic
969237158 4:5873664-5873686 CCAGACCCCACCTCCAATACTGG + Intronic
969351089 4:6598323-6598345 CCAGCCCCAGGCACCCATGGCGG + Exonic
969665980 4:8557890-8557912 CCTGCTCCCAGCTCCCACCCTGG + Intergenic
969821566 4:9724727-9724749 CCAGGCCCCAGCTCCAACACTGG + Intergenic
969966995 4:11007126-11007148 TCAGCCACCACCTCCCAGGCAGG - Intergenic
970007831 4:11427960-11427982 CTAGACCCCAGCTCCCAGGAAGG - Intronic
970345864 4:15151329-15151351 GCAGCCACCATCTCCCATGTTGG - Intergenic
970572733 4:17398659-17398681 CCAGGCCCCACCTCCAATACTGG + Intergenic
970707033 4:18816656-18816678 CCAGGCCCCACCTCCAATACTGG - Intergenic
972331292 4:38066693-38066715 AGAGCCCCCAGCTCCCCTCCAGG - Intronic
972648284 4:40990929-40990951 CCTGCCCCCAACCCCCATTCAGG - Intronic
972944937 4:44242673-44242695 CCAGGCCCCATCTCCAATACTGG - Intronic
973780266 4:54282546-54282568 CCAGTCCCCACCTCCAATACTGG + Intronic
973780573 4:54284722-54284744 CCAGGCCCCACCTCCAATACTGG + Intronic
975752899 4:77542548-77542570 CCAGGCCCCATCTCCAATACTGG + Intronic
976129605 4:81870636-81870658 CCTGCTCCCAGCACCCATTCTGG + Intronic
976589503 4:86835031-86835053 CCAGGCCCCACCTCCAATACTGG + Intronic
977000151 4:91488491-91488513 CCAGGCCCCTCCTCCAATGCTGG - Intronic
977015760 4:91691872-91691894 CCAGGCCCCACCTCCAATACAGG + Intergenic
977607000 4:98993968-98993990 CCTGGCCTCAGCTCCCATTCTGG - Intergenic
979361780 4:119773760-119773782 CCAGGCCCCACCTCCAATACTGG + Intergenic
980065880 4:128187763-128187785 CCAGGCCCCACCTCCAATACTGG - Intronic
980190323 4:129516809-129516831 CCAGACCCCACCTCCAATGTTGG + Intergenic
980457552 4:133065422-133065444 CCAGGCCCCTCCTCCAATGCTGG + Intergenic
981262747 4:142741461-142741483 CCAGGCCCCATCTCCAATACTGG + Intronic
981651050 4:147059550-147059572 CCACCCACCCCCTCCCATGCTGG + Intergenic
982176047 4:152706580-152706602 CCAGCTCCCAGCTGTCATTCAGG - Intronic
982280702 4:153681236-153681258 CCAGCCCCCAGCCCCACTTCTGG + Intergenic
983323887 4:166228225-166228247 CCAGGCACCAGCACCCATGCTGG - Intergenic
984400368 4:179256939-179256961 CCAGCCTGCAGCTCCCAGACTGG + Intergenic
984816385 4:183841112-183841134 CCCGCCCCGACCTCCCGTGCTGG + Intergenic
985060479 4:186072734-186072756 CCAGCCCCCACCTCCAACACTGG + Intronic
985634233 5:1028132-1028154 CCAGCACCCAGCCCCCGTCCTGG - Intronic
985651782 5:1111067-1111089 CCAGCCCCCACCCCGCGTGCTGG - Intronic
985679069 5:1246534-1246556 CCAGGCCCCCGCTCCCAGGCGGG - Intergenic
985784651 5:1887388-1887410 ACAGCTCCCAGCGCCCCTGCTGG - Intergenic
986329486 5:6707003-6707025 CCATACCCCAGGCCCCATGCAGG + Intergenic
986979146 5:13426896-13426918 CTAGCCCCCAAATCCCATGAAGG + Intergenic
987123012 5:14785275-14785297 CCAGGCCTCAGCTCCCACACTGG - Intronic
987187958 5:15444521-15444543 CCAGGCCCCACCTCCAATACTGG - Intergenic
987543683 5:19286692-19286714 CCAGGTCCCACCTCCAATGCTGG + Intergenic
988047119 5:25970922-25970944 CCAGGCCCCACCTCCCACACTGG - Intergenic
989111266 5:37908459-37908481 CCAGGCCCCATCTCCAATACTGG - Intergenic
989637933 5:43556598-43556620 CCAGCCCCCAGCGGCCTTCCCGG - Exonic
990492860 5:56319393-56319415 CCAGCCCCCAGATCTCAGTCCGG + Intergenic
992054696 5:72976778-72976800 CCAGCCCCCAACCCCCAAACAGG + Intronic
992448627 5:76855877-76855899 CCAGGCCCCACCTCCAATGGTGG - Intronic
992716169 5:79513745-79513767 CCTGCCCCCAGCTCCAGGGCGGG + Exonic
993330945 5:86599194-86599216 CCAGGCCCCATCTCCAATACTGG - Intergenic
994221568 5:97201586-97201608 CCAGGCCCCAGCTCCAACACTGG + Intergenic
995019169 5:107347677-107347699 CCTTCTCCCAGCTCCTATGCTGG - Intergenic
995132600 5:108646502-108646524 CCAGACCCCACCTCCAATACTGG - Intergenic
997163920 5:131638020-131638042 CCAGTCCCCAGTCCCCAGGCCGG - Intronic
997195547 5:131976926-131976948 CCTGCCTCCTGGTCCCATGCTGG - Intronic
997254528 5:132418172-132418194 CCAGGCCCCACCTCCAATGCTGG - Intronic
997602664 5:135150986-135151008 CCAGCCCCCACCACCCAATCGGG - Intronic
998042976 5:138965046-138965068 CAAGCCCCCAGCCTCCCTGCAGG - Intronic
998063169 5:139135192-139135214 CCAGCCCCCAGCTGGCAAGGTGG + Intronic
998128518 5:139639493-139639515 CCATCCCCCACCACACATGCAGG - Intergenic
998325621 5:141277505-141277527 CCAGGCCCCATCTCCAATCCTGG - Intergenic
1000269859 5:159673538-159673560 CCAGGCCCCAGCTCCAATACTGG - Intergenic
1001229220 5:169971291-169971313 TCAGGCCCCAGCTCCCCGGCAGG - Intronic
1001664449 5:173421062-173421084 CCAGCCCCCAGCCCCCCACCTGG - Intergenic
1001715484 5:173811649-173811671 CCAGGCCCCACCTCCCATATTGG - Intergenic
1002639173 5:180622559-180622581 CCAGCACCCAGGCCCTATGCTGG + Intronic
1002815961 6:680584-680606 CCAGCCAGCAGCTGCCCTGCAGG - Intronic
1003318757 6:5034406-5034428 CCAGGCCCCATCTCCCACACTGG - Intergenic
1004871990 6:19914536-19914558 CCAGCAAGCAGCTCCCATGATGG + Intergenic
1005147019 6:22703012-22703034 CCAGGCCCCACCTCCAATACTGG + Intergenic
1005958746 6:30682217-30682239 CTACCCCCCCACTCCCATGCAGG - Intronic
1005999784 6:30955860-30955882 CCAGCCCCCAGCCCCCAGGGAGG + Intergenic
1006117046 6:31781003-31781025 CCAGCACCCAGCCCACCTGCAGG + Exonic
1006169142 6:32083065-32083087 CCAGGCAGCAGCTCTCATGCAGG + Intronic
1006340850 6:33446208-33446230 CCAGGCCCCAGAACACATGCTGG - Intronic
1006376430 6:33674029-33674051 ACAGCCCCCTACTCCCCTGCAGG - Intronic
1006436983 6:34030871-34030893 GGAGCCCCCAGGGCCCATGCTGG - Intronic
1007391862 6:41553947-41553969 CCTTCCCCCATCTTCCATGCAGG - Intronic
1009401310 6:63259382-63259404 CCAGGCCCCACCTCCAATACTGG + Intergenic
1009630185 6:66188305-66188327 CCCACCCCCAACACCCATGCTGG - Intergenic
1009922758 6:70083047-70083069 CCAACCCCCAGGCCCCAGGCTGG - Intronic
1010021294 6:71162842-71162864 CCAGGCCCCACCTCCAATACTGG + Intergenic
1011172097 6:84516636-84516658 CCAGGCCCCACCTCCAATGTTGG - Intergenic
1011519948 6:88194394-88194416 CCAGCCCCCAGGCACCATTCAGG - Intergenic
1011533091 6:88346210-88346232 CCAGGCCCCACCTCCAATACTGG + Intergenic
1012230713 6:96758202-96758224 CCAGGCCCCACCTCCAATACTGG - Intergenic
1012785901 6:103625365-103625387 CCAGGCCCCAGCTCCAATACTGG + Intergenic
1012809582 6:103940351-103940373 CCAGCCCCCACCTCCAACACTGG - Intergenic
1013315571 6:108939326-108939348 CCAGGCCCCACCTCCAATCCAGG - Intronic
1013709990 6:112885935-112885957 CCAGCCCCCCGCCCCCAGACCGG - Intergenic
1014878723 6:126694790-126694812 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1015477673 6:133671676-133671698 CCAGGCCCCAGCTCCATTCCTGG + Intergenic
1015645644 6:135385156-135385178 CCAGCCTCTAGCTACCATGATGG + Intronic
1015999952 6:139031889-139031911 CCAGCACCCATTTCCCATTCTGG - Intronic
1016433161 6:144008478-144008500 CCGACCCCCAGCTCCCCGGCGGG - Intronic
1016537849 6:145128147-145128169 GCAGCACCCAGCTCACTTGCGGG - Intergenic
1016889677 6:148993606-148993628 CCAGGCCCCACCTCCAATACTGG - Intronic
1017491041 6:154945322-154945344 CCAGCCCCGGTCTACCATGCAGG + Intronic
1017636368 6:156447497-156447519 CCTGCCCACCTCTCCCATGCAGG + Intergenic
1017675834 6:156812776-156812798 GCAGCCCCCATCTCCCTTGATGG + Intronic
1017680907 6:156862782-156862804 CCAGGGCCCAGCCCCCAAGCGGG - Intronic
1017757781 6:157544234-157544256 CAAGGGCCCAGCTCCCATACTGG + Intronic
1018072123 6:160174043-160174065 TCAGCCCCCAGGTCCCTTTCTGG - Intronic
1018172736 6:161154513-161154535 CCTGCCCCCTGCTCCCACACTGG - Intronic
1018683044 6:166280726-166280748 CCAGACCCAAGCTCCGCTGCCGG + Intergenic
1018771361 6:166973949-166973971 CCAGGCCCCATCTCCAATACTGG - Intergenic
1019109953 6:169701922-169701944 ACAGCACCCAGCTCCCAGGAGGG + Intronic
1019611981 7:1941286-1941308 CCAGCCCCCAGCCCCCAGCCAGG + Intronic
1019768192 7:2866648-2866670 CCATCCCCCACCCTCCATGCTGG + Intergenic
1019954758 7:4404832-4404854 CCAGGCCCCACCTCCAACGCTGG - Intergenic
1020011777 7:4809225-4809247 CCAGGCCCGAGCGCCCCTGCGGG - Intronic
1020103150 7:5406954-5406976 CCAGCCCCCAGCGTTCCTGCAGG + Intronic
1020212410 7:6166567-6166589 CCAGGCCTCAGCGCCCGTGCTGG - Intronic
1020317184 7:6914133-6914155 CCAGGCCCCAGCTCCAACACTGG - Intergenic
1020482403 7:8678519-8678541 CCAGCAAACAGCTCCAATGCTGG - Intronic
1021615378 7:22498296-22498318 CCAGACCCCAGCTCCCGCACTGG + Intronic
1021767219 7:23961959-23961981 CCAGGCCCCACCTCCAGTGCTGG + Intergenic
1021855675 7:24852916-24852938 TAAGCCCCCTGCTCCCATGTAGG - Intronic
1022023237 7:26421727-26421749 CCAGACCCCACCTCCAATACTGG - Intergenic
1022034250 7:26518867-26518889 CCCTCCCTCAGCTCCCATTCAGG - Intergenic
1022049972 7:26657285-26657307 ACAGCCCACTGCTCCCCTGCAGG + Intergenic
1022459561 7:30592725-30592747 TCTGCCCCCAGCTCACATTCTGG + Intergenic
1022721130 7:32942749-32942771 CAAGCCCCCAGGACCCAGGCAGG - Intergenic
1022749803 7:33213106-33213128 AGAGCCCCCAGGTCCCAGGCAGG + Intronic
1023396589 7:39757455-39757477 GCAGGCCCCAGCTCGCATGATGG + Intergenic
1023668678 7:42553329-42553351 CCAACCCCCAGCCCACATACTGG - Intergenic
1023707504 7:42957175-42957197 CCAGGCCCCACCTCCAATGCTGG - Intergenic
1023732631 7:43206636-43206658 CCCTCCCCCACCTCCCATACTGG + Intronic
1023922107 7:44637733-44637755 CCACCCCCCAACCCCCATCCCGG - Intronic
1024266876 7:47613488-47613510 CCTGCCCCCAGATCCCAGCCTGG - Intergenic
1024755136 7:52520017-52520039 CCAGGCCCCACCTCCAATACAGG + Intergenic
1026401053 7:70013361-70013383 CCCACCTCCAGCTCCCAGGCTGG - Intronic
1027232931 7:76282587-76282609 CCCGCCCCCAGCCCCCTTTCCGG + Intronic
1027935778 7:84600224-84600246 CCAGGTCCCACCTCCAATGCTGG - Intergenic
1028344420 7:89761647-89761669 CCAGCCCACACCTGCCATACTGG + Intergenic
1028377119 7:90156336-90156358 CCAGACCCCAGCTCCCTCACTGG - Intronic
1029545034 7:101206200-101206222 CCATCCCCCAACTCCCAGGACGG + Exonic
1029614598 7:101648406-101648428 CCAAAGCCCAGGTCCCATGCTGG + Intergenic
1029977624 7:104849436-104849458 CCAGCCCCCAGGAGCCAGGCTGG - Intronic
1030577963 7:111313848-111313870 CCAGGCCCCACCTCCAGTGCTGG - Intronic
1030677439 7:112398703-112398725 CCAGCCCACAGCAACCCTGCAGG - Intergenic
1031035724 7:116785576-116785598 CCAGGCCTCAGCTCCCACACTGG + Intronic
1032068798 7:128791513-128791535 CCAGCCCGCGGCTCCCGCGCCGG - Intronic
1032348715 7:131140401-131140423 CCAGGCCCCACCTCCAATGCTGG - Intronic
1032590045 7:133183455-133183477 CCAGCCCAGAGCTCTCATGGAGG - Intergenic
1033533199 7:142286961-142286983 CCAGGCCCCACCTCCAATACTGG + Intergenic
1033616584 7:143022431-143022453 CCAGGCCCCACCTCCAATACTGG + Intergenic
1033883332 7:145914793-145914815 GCAAACCCCAGCTCCCAGGCAGG - Intergenic
1034405708 7:150901252-150901274 CCTGCCCCCAGCTCCAGAGCAGG + Intergenic
1035015292 7:155760468-155760490 CCAACCTCCAGGTCCCATGAGGG - Intronic
1035096547 7:156360526-156360548 AGATCCCCCAGCTCCCATCCAGG - Intergenic
1035212377 7:157337449-157337471 CCAGCCGGCCGCTCCCAGGCCGG - Intronic
1035766184 8:2107498-2107520 CCAGCCCACAGCACCGATCCTGG - Intronic
1036621891 8:10429661-10429683 CCAGGCCCCACCTCCAATACTGG + Intergenic
1037099904 8:15032488-15032510 CCAGGCCCCAGATGCCAGGCTGG + Intronic
1037129158 8:15386593-15386615 CCAGACCCCACCTCCAATGTTGG - Intergenic
1037621287 8:20565801-20565823 CCAGGCCCCACCTCCAATGCTGG - Intergenic
1038195158 8:25360418-25360440 CCACCCCCCACCCCCCATACTGG - Intronic
1038412263 8:27367894-27367916 CCAGGCCCCACCTCCCACACTGG + Intronic
1038872773 8:31514285-31514307 CCAGCCCCCAGCCCCCCAACAGG + Intergenic
1038939316 8:32286343-32286365 TCAGCCCCCACCTACCTTGCTGG - Intronic
1039072550 8:33659961-33659983 CCAGCCCCCAGCTCCAGGGCTGG - Intergenic
1039976731 8:42372752-42372774 CCAGGCCCCACCTCCAATACTGG + Intergenic
1040911820 8:52527342-52527364 CCAGGCCCCATCTCCAATTCTGG + Intergenic
1041426041 8:57721750-57721772 CCAGGCCCCAACTTCCATGCTGG + Intergenic
1042109667 8:65367442-65367464 CCAGCCCACCCTTCCCATGCAGG + Intergenic
1043079977 8:75754863-75754885 GCAGCACCCAGTTCCAATGCTGG - Intergenic
1044117430 8:88351743-88351765 CCAGGCCCCACCTCCAATACTGG - Intergenic
1044900567 8:96939386-96939408 CCAACCCCCAGCTAGCATACTGG - Intronic
1045526659 8:102946169-102946191 CCATCCTCCAGCTTCCATGGTGG + Intronic
1046209663 8:111052901-111052923 ACAGCCTCCTGCTACCATGCCGG + Intergenic
1046350139 8:112998721-112998743 CCAGGCCCCACCTCCAATACTGG - Intronic
1046611404 8:116429593-116429615 CCAGGCCCCACCTCCAATACTGG + Intergenic
1047050941 8:121112399-121112421 CCAGACCCCACCTCCAATACAGG + Intergenic
1047247276 8:123156794-123156816 CCATCCCGCAGCTCCCTCGCCGG + Intergenic
1047340811 8:123978381-123978403 CCAGCTCTCAGCTCCCACCCTGG - Intronic
1048005051 8:130412247-130412269 CCAGGCCCCACCTCCAATACTGG - Intronic
1048188287 8:132264352-132264374 CCAGCCCCCAGCTATCAGGAGGG + Intronic
1048521446 8:135159109-135159131 TCAGACTCCATCTCCCATGCTGG + Intergenic
1048869293 8:138783943-138783965 CCAGAGCCCAGAGCCCATGCAGG + Intronic
1048916639 8:139190307-139190329 CCAGGCCCCACCTCCAATACTGG + Intergenic
1048952564 8:139508461-139508483 CCAGCCCCCACCTCACCTGAGGG + Intergenic
1048995386 8:139790785-139790807 CCAGGCCCCACCTCCAATGCTGG - Intronic
1049352512 8:142171703-142171725 CCAGCCCCCAGCACCCACAGAGG + Intergenic
1049360912 8:142212250-142212272 CCAGCCCCGAGCACCCCTCCTGG - Exonic
1049368571 8:142252782-142252804 TCAGCCCCGAGCCCCCATCCTGG + Intronic
1049572693 8:143376642-143376664 CCCACCCGCACCTCCCATGCCGG - Exonic
1049748140 8:144271654-144271676 CCAGGGCCCAGCACCCCTGCTGG - Intronic
1049756232 8:144312360-144312382 CCAGCCCCGAGCTCCGAGGTTGG - Intronic
1051499985 9:17765844-17765866 CCAGCCCCCAGCTCAGTTCCAGG + Intronic
1052722214 9:32185708-32185730 CCAGGCCCCACCTCCAATACTGG + Intergenic
1052854327 9:33397743-33397765 TCCAACCCCAGCTCCCATGCTGG + Intronic
1053537211 9:38937754-38937776 CCAGCCCACAGCTAACAAGCTGG - Intergenic
1053610631 9:39709812-39709834 CCAGGCCCCACCTCCAATACTGG + Intergenic
1053868666 9:42467834-42467856 CCAGGCCCCACCTCCAATACTGG + Intergenic
1054087622 9:60761345-60761367 CCAGGCCCCACCTCCAATACTGG - Intergenic
1054242892 9:62632583-62632605 CCAGGCCCCACCTCCAATACTGG - Intergenic
1054557016 9:66667101-66667123 CCAGGCCCCACCTCCAATACTGG - Intergenic
1054628924 9:67426176-67426198 CCAGCCCACAGCTAACAAGCTGG + Intergenic
1055102820 9:72482698-72482720 CCAGGCCCCACCTCCAACGCTGG - Intergenic
1055933690 9:81585526-81585548 ACAGCACGCAGCTCTCATGCAGG + Exonic
1056333243 9:85539379-85539401 CCGACCCCCAGTTCCCTTGCAGG + Intergenic
1056941691 9:90961618-90961640 GCAGCTCCCAGCTCTCCTGCTGG - Intergenic
1057557991 9:96102788-96102810 CCAGGCCCCACCTCCAACGCTGG + Intergenic
1059371596 9:113844064-113844086 CCAGGCCCCATCTCCAATACTGG + Intergenic
1060154233 9:121308139-121308161 CCAACCCACAGCTCCCTTGAAGG + Intronic
1060435764 9:123591425-123591447 CCAGCCCCACGCTCCCAACCCGG - Intronic
1060481539 9:124019031-124019053 CCAGTCCCCAGCTCCACTGGGGG - Intronic
1060768350 9:126311840-126311862 CCAGACCCCCACTCCAATGCTGG + Intergenic
1060838696 9:126777692-126777714 CCCTCCCCCAGCTCCCAGGAGGG - Intergenic
1061105279 9:128525377-128525399 AGAGCCCCCAGCTCCCAGCCAGG + Exonic
1061145137 9:128793192-128793214 CCAGCCCCTATCTCCCACCCTGG - Intronic
1061178479 9:129010848-129010870 CCAGCCCCCAGCTCCCATGCCGG - Intronic
1061276071 9:129569954-129569976 GCAGCCCCCAGGACCCATGGTGG + Intergenic
1061887888 9:133601959-133601981 CCAGCCCCCAGCTTCCCTGCTGG - Intergenic
1061892506 9:133630154-133630176 CCAGCCGGCAGCCCCCATGCTGG + Intergenic
1062055910 9:134469685-134469707 CCAGCTCCCAGCCCCCACGCTGG - Intergenic
1062344390 9:136108229-136108251 CCTGCCCCCAGCTCTCACGCCGG - Intergenic
1062474649 9:136720993-136721015 CCAGCCAGAAGCTGCCATGCAGG + Intronic
1062490966 9:136804741-136804763 CCCGCCCCCACCTCCCATCAGGG + Exonic
1062504269 9:136865472-136865494 CCTGTCCCCAGCTCCCACTCAGG + Intronic
1186147085 X:6635712-6635734 CCAGGCCCCACCTCCAATACTGG + Intergenic
1186574365 X:10749882-10749904 CCAGTCCCCACCTCCAATACTGG + Intronic
1187114438 X:16334611-16334633 CCAGGCCCCACCTCCCACGTTGG + Intergenic
1187419604 X:19122701-19122723 CCTGCCCCGAGCTCCCAGCCCGG - Intergenic
1188029269 X:25246501-25246523 CCAGCCAAAAGCTCTCATGCAGG - Intergenic
1188211717 X:27433643-27433665 CCAGGCCCCACCTCCCACACTGG - Intergenic
1188646359 X:32572772-32572794 CCAGGCCCTACCTCCAATGCTGG - Intronic
1189463810 X:41263115-41263137 CCAGGCCCCACCTCCAATACTGG - Intergenic
1189594260 X:42547750-42547772 CCAGGCCCCACCTCCAATACTGG + Intergenic
1189748958 X:44199091-44199113 CCAGGCCCCACCTCCAACGCTGG - Intronic
1189847193 X:45148675-45148697 TCAGGCCCCACCTCCAATGCTGG + Exonic
1189949463 X:46213906-46213928 CCAGCCCCCACCTCCAACACTGG + Intergenic
1190090120 X:47430157-47430179 CCAGGCCCCACCTCCAATACTGG - Intergenic
1192201233 X:69067998-69068020 CCAGCCCCTGGATCCCAAGCAGG + Intergenic
1192210002 X:69121852-69121874 CCTGACCCCAGGGCCCATGCCGG + Intergenic
1192814311 X:74575206-74575228 CCAACCACCTCCTCCCATGCTGG + Intergenic
1194151001 X:90325042-90325064 CCAGGCCCCACCTCCAATACTGG + Intergenic
1194168775 X:90556089-90556111 CCAGTCCCCACCTCCAACGCTGG - Intergenic
1195062567 X:101210564-101210586 TCAGCCTTCAGATCCCATGCTGG + Intergenic
1195108561 X:101623505-101623527 CCAGGCCACAGCTCCCTTTCCGG - Intronic
1195653851 X:107315445-107315467 CCAGGCCCCATCTCCAATACCGG - Intergenic
1195992040 X:110692320-110692342 CCCACCCCCAACTCCCAAGCTGG - Intronic
1196166950 X:112545954-112545976 CCAGCCCCCAACCCCCAAACAGG + Intergenic
1196721621 X:118859738-118859760 CCAGGCCCCAGCTCCAACACTGG - Intergenic
1197004514 X:121480405-121480427 CCAGGCCCCGGGTCCCATGCTGG + Intergenic
1197281422 X:124541282-124541304 CCAGGCCCCATCTCCAATACTGG - Intronic
1197404003 X:126027900-126027922 CCACCCCCCAGCCACCCTGCTGG - Intergenic
1197585109 X:128337505-128337527 CCAGGCCCCACCTCCCACACTGG - Intergenic
1197609014 X:128617449-128617471 CCAGGCCCCACCTCCAATGTTGG + Intergenic
1199148068 X:144395062-144395084 CCAGGCCCCACCTCCCACACTGG + Intergenic
1199715940 X:150507479-150507501 CCAGTCCTCTGCTCCTATGCTGG - Intronic
1199953346 X:152723051-152723073 CCAGCCCCCAGCATGCATGAAGG - Intergenic
1199956336 X:152745399-152745421 CCAGCCCCCAGCATGCATGAAGG + Intergenic
1200059289 X:153477103-153477125 TCAGTTCCCAGCTCCCATGGAGG - Intronic
1200060248 X:153480821-153480843 CCAGGCCACAGCTGCCATGAGGG + Intronic
1200099851 X:153685012-153685034 CCAGCCCAGAGCTCCTATGGTGG - Intronic
1200179325 X:154140827-154140849 CCAGCCCCCACATCCCAGGAAGG - Intergenic
1200497369 Y:3901795-3901817 CCAGGCCCCACCTCCAATACTGG + Intergenic
1200515015 Y:4133875-4133897 CCAGTCCCCACCTCCAACGCTGG - Intergenic
1200838050 Y:7752386-7752408 TCACCCCCAACCTCCCATGCTGG - Intergenic
1201392477 Y:13513228-13513250 CCAGCCCCCAGGTTTCAGGCTGG + Intergenic