ID: 1061178972

View in Genome Browser
Species Human (GRCh38)
Location 9:129013021-129013043
Sequence TGAGCCAAGTTACCCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061178967_1061178972 27 Left 1061178967 9:129012971-129012993 CCGGAAGCAGCACAGCGCGTGGG 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1061178972 9:129013021-129013043 TGAGCCAAGTTACCCAAAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061178972 Original CRISPR TGAGCCAAGTTACCCAAAGC AGG Intronic
903263663 1:22143768-22143790 TGTCCCAAGCTGCCCAAAGCTGG - Intronic
904638806 1:31905898-31905920 AGAGCCAACTTAACCATAGCTGG - Intergenic
905798915 1:40831037-40831059 AGAGCCAAGTTAGCCAGAGCTGG - Intronic
907888855 1:58619325-58619347 TGAGCTAACTTTCCCAAAGCGGG + Intergenic
909191594 1:72559183-72559205 TGAGCCAGCTTTCCCAAATCAGG - Intergenic
910222962 1:84907468-84907490 TGTGCCAAGTTGCCCTGAGCTGG + Intergenic
911298757 1:96148956-96148978 TGAGCCCAGGTGCCTAAAGCAGG - Intergenic
914975300 1:152355575-152355597 TGATCCATGTTGGCCAAAGCTGG + Exonic
915171540 1:153981624-153981646 TAATCCAAGTTACCCAAAACAGG + Intronic
916120677 1:161525563-161525585 TGAGCACAGTTCCTCAAAGCGGG - Exonic
916130443 1:161607195-161607217 TGAGCACAGTTCCTCAAAGCGGG - Intronic
917451766 1:175153085-175153107 TAAGCCAGTTTACCCAAAACTGG - Intergenic
918205064 1:182300854-182300876 TGAGCCAATCTTCCCACAGCTGG + Intergenic
918954109 1:191182816-191182838 TCACCCAAGTCACCCAAAGTGGG + Intergenic
1067934734 10:50600047-50600069 TCAGCCAAGTGACCCCAAGGCGG + Intronic
1072674914 10:97458614-97458636 TGAGCCATCTTCCCCAAAGCAGG - Exonic
1072768302 10:98114545-98114567 TGAGCCCAGTTGCCCACAGCAGG - Intergenic
1072786315 10:98285521-98285543 AGGGCCAAGTACCCCAAAGCTGG + Intergenic
1072807315 10:98431941-98431963 TGTGCTAAGTTACCAAAATCTGG + Intronic
1073497114 10:103902457-103902479 TGAGCCAAGTTGCCAAAAGGAGG + Intronic
1077212891 11:1381703-1381725 TGACCTGACTTACCCAAAGCCGG - Intergenic
1078466465 11:11553784-11553806 TGAGCCAAGTCGCCCGCAGCTGG + Intronic
1082647249 11:55742790-55742812 TGAGCCAACTCACCAGAAGCCGG - Intergenic
1084501523 11:69538336-69538358 TGACCCAAGTTGACCAAAGCTGG + Intergenic
1084898785 11:72294470-72294492 TGAGCTCAGTGACCCAGAGCGGG + Intronic
1087501204 11:98956222-98956244 TGAGACAAGTCATCCAAATCTGG + Intergenic
1090551491 11:127825030-127825052 TAAGCCAAGTTACATAAAGCAGG - Intergenic
1095968291 12:47883917-47883939 TGAGCCAAGATAACCTAAGCTGG + Intronic
1102424899 12:112836003-112836025 TGAGGCAAGCAACCAAAAGCAGG - Intronic
1103593797 12:122010766-122010788 GGAGCCAAGTGAGCCAAAGCTGG + Intergenic
1104279647 12:127363434-127363456 TGAGCCAAGTTACCCACTGGTGG + Intergenic
1110708591 13:78624924-78624946 TGGGCAAAGTTGCCCAAAACAGG + Intronic
1111927055 13:94475168-94475190 TGAGCCGTGTGTCCCAAAGCAGG - Intronic
1117339838 14:54783684-54783706 TTAGCCAACTAACACAAAGCTGG - Intronic
1122069194 14:99194733-99194755 TGAGCCAAGTCATCCAAGCCTGG - Intronic
1124410273 15:29430971-29430993 TGTGCGTAGCTACCCAAAGCTGG + Intronic
1127304640 15:57692907-57692929 TGAGCCAAATAACAGAAAGCTGG + Intronic
1129394015 15:75234583-75234605 TGTGCCAGGCTCCCCAAAGCTGG + Intergenic
1129560494 15:76561556-76561578 TAAGAAAAGTTACTCAAAGCTGG - Intronic
1131021791 15:89105369-89105391 GGAGTCAAGTTACCCAATGCAGG - Intronic
1131432362 15:92396829-92396851 TGAGCCCAGCTGCCCAAAGTTGG - Intronic
1135067765 16:19324967-19324989 TGAGAAGAGGTACCCAAAGCAGG + Intergenic
1139367133 16:66440463-66440485 TGAGTCAGGGAACCCAAAGCAGG - Intronic
1142804303 17:2363416-2363438 TGAGGCCAGTTTCCCAAGGCTGG + Intronic
1149042490 17:52206506-52206528 TGAGCCAAGTTAAGCACAGAGGG - Intergenic
1152542376 17:80982727-80982749 TGGGCCAAGCTGCCCACAGCCGG - Intergenic
1157438353 18:47690147-47690169 TGAGGGAAGTTATACAAAGCTGG - Intergenic
1161005876 19:1936187-1936209 TGGGCCAGGTTCCCCACAGCAGG - Intergenic
1164257095 19:23537599-23537621 TAAGCCAATTTACCAAAAGAAGG - Intronic
1168368010 19:55806010-55806032 TGAGGCAAGTTTCCCAACGAAGG - Intronic
925059458 2:879892-879914 TGTGGCCAGTTACCCAAAACAGG - Intergenic
926055261 2:9770703-9770725 TGAGCTCAGTGGCCCAAAGCAGG - Intergenic
926072449 2:9908992-9909014 TGAGCCAAGCTACCAGAATCTGG + Intronic
928727496 2:34191728-34191750 TGAGCAAAGTGACACAAAGGTGG - Intergenic
930122231 2:47769551-47769573 TTTGCCATGTTGCCCAAAGCTGG - Intronic
930438281 2:51374746-51374768 TGAGCCAATTTATCCAAACCAGG + Intergenic
930456744 2:51615300-51615322 TGAGCCCTTTTAGCCAAAGCTGG + Intergenic
931651318 2:64471417-64471439 TGAGACAAGCTAACCAAAACAGG - Intergenic
935388623 2:102526740-102526762 TGAGCAGAGTTCTCCAAAGCTGG + Intronic
935896250 2:107740796-107740818 GAAGCCAAGTAACACAAAGCAGG + Intergenic
936060301 2:109291130-109291152 TGAGACAAGTGCCCCAAATCAGG - Intronic
936113973 2:109687557-109687579 AGAGCCAGGTTTCCCACAGCTGG - Intergenic
936695652 2:114944326-114944348 TTAGACCAGTTATCCAAAGCTGG - Intronic
940102798 2:150061491-150061513 TAAGCCAATTTACAGAAAGCAGG + Intergenic
940109592 2:150136937-150136959 TAAGCCATGTGACCCAAAGAGGG + Intergenic
940886812 2:158997267-158997289 AGAGCCAAGTTTCCCACAGCTGG + Intronic
941711465 2:168718597-168718619 TTTGCCAAGTAACACAAAGCTGG - Intronic
942599163 2:177622586-177622608 TGAGGGAAGTTAGGCAAAGCAGG - Intergenic
1171334332 20:24370215-24370237 TGAGCCTAGTTACCAAGAGAGGG - Intergenic
1173028156 20:39328797-39328819 TGAGGCAAGAAACGCAAAGCAGG + Intergenic
1174206600 20:48844743-48844765 TGAGCCGAATTACCCAACCCTGG + Intergenic
1181533321 22:23529489-23529511 TGAGCCAAGGAAACCACAGCAGG + Intergenic
1183223741 22:36534614-36534636 TGTGCTAAGTTACCAAAATCTGG + Intergenic
1183971780 22:41482865-41482887 TGAGCCCAGATCTCCAAAGCTGG + Intronic
1184384093 22:44164425-44164447 TGTGCCAAGTTACCTATAGGAGG + Intronic
960624594 3:119669127-119669149 TAAGCCAAATTACCCTAATCTGG + Intronic
961619157 3:128209944-128209966 AGAGCAAAGTTTCCCAAAGTGGG - Intronic
962911452 3:139855279-139855301 TGAGCCATGTTGTCCACAGCTGG - Intergenic
967482537 3:189990181-189990203 TTAGCCAAGTTATACAAAACTGG - Intronic
967583414 3:191186549-191186571 TGAGCCCAGTTGCCTAAAGAAGG - Intergenic
969214213 4:5709546-5709568 TAAGCCAAGTTCCCCACACCAGG + Intronic
970236920 4:13968165-13968187 TGGACCACGTTACCCAATGCAGG + Intergenic
973045649 4:45532485-45532507 TGAGCCAGGTTGCCTAAAGAAGG - Intergenic
976708438 4:88042891-88042913 TGAGCACAGTTACCCAGAGAAGG + Intronic
979452258 4:120886369-120886391 TGAACCAAGTTCCCAACAGCAGG + Intronic
989957125 5:50371374-50371396 TGAGCCTAGGTGCCTAAAGCAGG - Intergenic
993832779 5:92780016-92780038 TTAGCCAAGTTTTCCAAAGAAGG - Intergenic
1002909575 6:1479136-1479158 TGAGTCAAGTTAGCCACAACTGG - Intergenic
1004648503 6:17585970-17585992 TGAGCCAAGTGATCCAAGGATGG - Intergenic
1005400231 6:25424412-25424434 TGAGCCAAATTGACCAAAGGTGG + Intronic
1005928985 6:30466664-30466686 AGAGCCAAGCCACCCACAGCAGG + Intergenic
1006191483 6:32212460-32212482 TGAGCCAAGGTAACCAACGCCGG - Exonic
1010416727 6:75620061-75620083 TGAGGCAAGGTAGCCCAAGCTGG - Intronic
1012052827 6:94364712-94364734 TGGGCCAAGTAACTCAAAGTTGG - Intergenic
1013908082 6:115240102-115240124 TGAGCCCAGTTGCCTAAAGAAGG + Intergenic
1016771427 6:147856678-147856700 TGAGCCAAAGGATCCAAAGCTGG + Intergenic
1018319269 6:162589046-162589068 TGAGCCATGGTGCCCAAAGGTGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1021529237 7:21624279-21624301 TGAGCAAATTTAACCAAAGGAGG - Intronic
1022863778 7:34396166-34396188 TGAGCTAAGTGACCAAAAGAGGG + Intergenic
1025635511 7:63316763-63316785 TGAGGCAAGAGACCCAAGGCAGG - Intergenic
1025647184 7:63431407-63431429 TGAGGCAAGAGACCCAAGGCAGG + Intergenic
1025656059 7:63519568-63519590 ATAGCCAAGATACACAAAGCCGG + Intergenic
1026599594 7:71766217-71766239 TTATCCAAGTTACACAAGGCTGG - Intergenic
1029979284 7:104863014-104863036 AGAGCCCAGTTACACAGAGCTGG + Intronic
1030631077 7:111896537-111896559 AGAGTCAAGTTAACCAAAGAAGG - Intronic
1033456914 7:141511427-141511449 TTAGGGAAGTTTCCCAAAGCTGG - Intergenic
1036965461 8:13292528-13292550 TCAGCCAGGTTACCCAAAGGGGG - Intronic
1045882240 8:107055027-107055049 TGAGCCAAGACACTCAGAGCAGG + Intergenic
1048191031 8:132289332-132289354 TGTAACAAGTTACCCAAAGTTGG + Intronic
1055530444 9:77177938-77177960 TGGGTCAAGTTACGTAAAGCCGG + Intronic
1057598135 9:96433974-96433996 AGAGCCAAGTTTCCCTAAGATGG - Intergenic
1059512747 9:114864696-114864718 TGAGGCAAGCTTCCCACAGCAGG + Intergenic
1061178972 9:129013021-129013043 TGAGCCAAGTTACCCAAAGCAGG + Intronic
1061685225 9:132271116-132271138 TGAACAAATTTAGCCAAAGCAGG + Intronic
1187243025 X:17530820-17530842 TGTGCCACGGTACCCAAACCTGG - Intronic
1188390125 X:29609496-29609518 TGAGCCAAGACACACAAAGAAGG - Intronic
1188946432 X:36309663-36309685 TGAGCCAAGTGACAAAAAGAAGG - Intronic
1195067634 X:101252170-101252192 TTAGCCAACTTAGCCAAGGCTGG + Intronic
1197730587 X:129806031-129806053 TGAGACCAGTGACCCCAAGCAGG + Exonic
1198138953 X:133783410-133783432 TTAGCCAAGTTAAACAAAGTAGG + Intronic
1202074928 Y:21028011-21028033 TGAGCCCAGCTACCTAAAGAAGG + Intergenic