ID: 1061183227

View in Genome Browser
Species Human (GRCh38)
Location 9:129037121-129037143
Sequence GGCACCGGGCATCCCCGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061183227_1061183245 28 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183245 9:129037172-129037194 GCATGGGGTGAATAGGAGACTGG 0: 2
1: 0
2: 1
3: 12
4: 159
1061183227_1061183236 -1 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183236 9:129037143-129037165 CCGGCATGGTGGGACTATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 43
1061183227_1061183246 29 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183246 9:129037173-129037195 CATGGGGTGAATAGGAGACTGGG 0: 2
1: 0
2: 0
3: 8
4: 136
1061183227_1061183243 21 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183243 9:129037165-129037187 GGGTCCGGCATGGGGTGAATAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1061183227_1061183241 12 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183227_1061183242 13 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183242 9:129037157-129037179 CTATTGAGGGGTCCGGCATGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1061183227_1061183238 1 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183238 9:129037145-129037167 GGCATGGTGGGACTATTGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 111
1061183227_1061183240 11 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183240 9:129037155-129037177 GACTATTGAGGGGTCCGGCATGG 0: 1
1: 0
2: 0
3: 2
4: 73
1061183227_1061183239 6 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183239 9:129037150-129037172 GGTGGGACTATTGAGGGGTCCGG 0: 1
1: 0
2: 1
3: 6
4: 122
1061183227_1061183237 0 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183237 9:129037144-129037166 CGGCATGGTGGGACTATTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061183227 Original CRISPR GGCACCGGGCATCCCCGCGT TGG (reversed) Intronic