ID: 1061183232

View in Genome Browser
Species Human (GRCh38)
Location 9:129037135-129037157
Sequence GTCCCACCATGCCGGGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 268}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061183232_1061183247 23 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183247 9:129037181-129037203 GAATAGGAGACTGGGCAGAGTGG 0: 2
1: 0
2: 5
3: 70
4: 736
1061183232_1061183240 -3 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183240 9:129037155-129037177 GACTATTGAGGGGTCCGGCATGG 0: 1
1: 0
2: 0
3: 2
4: 73
1061183232_1061183248 30 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183248 9:129037188-129037210 AGACTGGGCAGAGTGGCTCAAGG 0: 1
1: 4
2: 34
3: 255
4: 871
1061183232_1061183242 -1 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183242 9:129037157-129037179 CTATTGAGGGGTCCGGCATGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1061183232_1061183246 15 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183246 9:129037173-129037195 CATGGGGTGAATAGGAGACTGGG 0: 2
1: 0
2: 0
3: 8
4: 136
1061183232_1061183239 -8 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183239 9:129037150-129037172 GGTGGGACTATTGAGGGGTCCGG 0: 1
1: 0
2: 1
3: 6
4: 122
1061183232_1061183243 7 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183243 9:129037165-129037187 GGGTCCGGCATGGGGTGAATAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1061183232_1061183241 -2 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183232_1061183245 14 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183245 9:129037172-129037194 GCATGGGGTGAATAGGAGACTGG 0: 2
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061183232 Original CRISPR GTCCCACCATGCCGGGCACC GGG (reversed) Intronic