ID: 1061183233

View in Genome Browser
Species Human (GRCh38)
Location 9:129037136-129037158
Sequence AGTCCCACCATGCCGGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 189}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061183233_1061183245 13 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183245 9:129037172-129037194 GCATGGGGTGAATAGGAGACTGG 0: 2
1: 0
2: 1
3: 12
4: 159
1061183233_1061183248 29 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183248 9:129037188-129037210 AGACTGGGCAGAGTGGCTCAAGG 0: 1
1: 4
2: 34
3: 255
4: 871
1061183233_1061183247 22 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183247 9:129037181-129037203 GAATAGGAGACTGGGCAGAGTGG 0: 2
1: 0
2: 5
3: 70
4: 736
1061183233_1061183242 -2 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183242 9:129037157-129037179 CTATTGAGGGGTCCGGCATGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1061183233_1061183240 -4 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183240 9:129037155-129037177 GACTATTGAGGGGTCCGGCATGG 0: 1
1: 0
2: 0
3: 2
4: 73
1061183233_1061183249 30 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183249 9:129037189-129037211 GACTGGGCAGAGTGGCTCAAGGG 0: 1
1: 1
2: 2
3: 36
4: 275
1061183233_1061183239 -9 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183239 9:129037150-129037172 GGTGGGACTATTGAGGGGTCCGG 0: 1
1: 0
2: 1
3: 6
4: 122
1061183233_1061183243 6 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183243 9:129037165-129037187 GGGTCCGGCATGGGGTGAATAGG 0: 1
1: 0
2: 1
3: 3
4: 90
1061183233_1061183241 -3 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183233_1061183246 14 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183246 9:129037173-129037195 CATGGGGTGAATAGGAGACTGGG 0: 2
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061183233 Original CRISPR AGTCCCACCATGCCGGGCAC CGG (reversed) Intronic