ID: 1061183241

View in Genome Browser
Species Human (GRCh38)
Location 9:129037156-129037178
Sequence ACTATTGAGGGGTCCGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061183232_1061183241 -2 Left 1061183232 9:129037135-129037157 CCCGGTGCCCGGCATGGTGGGAC 0: 1
1: 1
2: 2
3: 21
4: 268
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183233_1061183241 -3 Left 1061183233 9:129037136-129037158 CCGGTGCCCGGCATGGTGGGACT 0: 2
1: 0
2: 0
3: 14
4: 189
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183227_1061183241 12 Left 1061183227 9:129037121-129037143 CCAACGCGGGGATGCCCGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183235_1061183241 -10 Left 1061183235 9:129037143-129037165 CCGGCATGGTGGGACTATTGAGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1061183234_1061183241 -9 Left 1061183234 9:129037142-129037164 CCCGGCATGGTGGGACTATTGAG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1061183241 9:129037156-129037178 ACTATTGAGGGGTCCGGCATGGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061183241 Original CRISPR ACTATTGAGGGGTCCGGCAT GGG Intronic