ID: 1061184153

View in Genome Browser
Species Human (GRCh38)
Location 9:129042354-129042376
Sequence TGCCACGGCCCTGGGGACTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 382}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061184144_1061184153 16 Left 1061184144 9:129042315-129042337 CCAGCTACGGTTGACGCCAGGCC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG 0: 1
1: 0
2: 0
3: 31
4: 382
1061184147_1061184153 -5 Left 1061184147 9:129042336-129042358 CCTGCGGAAAGTCCTCTTTGCCA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG 0: 1
1: 0
2: 0
3: 31
4: 382
1061184143_1061184153 17 Left 1061184143 9:129042314-129042336 CCCAGCTACGGTTGACGCCAGGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG 0: 1
1: 0
2: 0
3: 31
4: 382
1061184146_1061184153 0 Left 1061184146 9:129042331-129042353 CCAGGCCTGCGGAAAGTCCTCTT 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG 0: 1
1: 0
2: 0
3: 31
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061184153 Original CRISPR TGCCACGGCCCTGGGGACTG TGG Exonic
900124794 1:1064602-1064624 GCCCACGGCCCTGGTGCCTGTGG - Intergenic
900586097 1:3433049-3433071 TGGGACGGCCCTGGGAACTGGGG - Intronic
900732307 1:4270280-4270302 TGCATAGGCCCTGGAGACTGTGG - Intergenic
901055533 1:6447262-6447284 GGCCCCGGCCCTGGCGCCTGCGG - Intronic
901169556 1:7246706-7246728 TGCCACGGCACTCTGGCCTGGGG - Intronic
901454742 1:9356622-9356644 AGCCAGGACCATGGGGACTGAGG - Intronic
902248002 1:15134459-15134481 TGCAAAGGCCCTGGGGTCAGAGG + Intergenic
902503377 1:16924841-16924863 TGCCACGGGCCTTGGGGTTGAGG + Intronic
903067786 1:20710434-20710456 TGCCATCGCCCTGAGGGCTGGGG - Intronic
903232121 1:21928205-21928227 AGCCACTTCCCTGGGCACTGTGG - Intronic
903330319 1:22593727-22593749 TGCCAGGACCCTGGGGTCGGGGG + Intronic
903450449 1:23450175-23450197 TGCCATGGCTCTGGGAGCTGAGG + Intronic
903559098 1:24214549-24214571 AGACACTGCCCTGGGGTCTGGGG - Intergenic
903764641 1:25726267-25726289 TGCCGTGGCCCTGGAGACCGTGG - Intronic
904239395 1:29134302-29134324 TCCCCCGGCCCTGGAGACCGGGG - Intergenic
904347015 1:29879242-29879264 TGTCACCGCTCAGGGGACTGGGG - Intergenic
904591237 1:31616736-31616758 TGTGAGGGCCCTGGGGGCTGTGG - Intergenic
904780100 1:32940085-32940107 TGCCAAGGCCCAGGGAAATGAGG + Intronic
905038134 1:34930246-34930268 TGCCTCGGCTGTGCGGACTGTGG - Intergenic
905385734 1:37602678-37602700 TGCCCAGGACCTGGGGACTCAGG + Intergenic
905477357 1:38238455-38238477 TGCCAAGGCCCTGGGGCAGGAGG - Intergenic
905918226 1:41700525-41700547 AGCCAAGGCCCTGGGCTCTGGGG - Intronic
906241388 1:44244420-44244442 GGGCTTGGCCCTGGGGACTGAGG - Intronic
906278518 1:44536510-44536532 TTCCAGGGCCCTGGGGACACAGG - Intronic
907267972 1:53274342-53274364 AGCCAAGGCCCTGGGCTCTGAGG - Intronic
910246684 1:85146276-85146298 TGCCAGGGGCCTGGGGGCTAAGG - Intergenic
912500074 1:110115773-110115795 TGCCATGGACCAGTGGACTGAGG - Intergenic
913047903 1:115089454-115089476 TAGCGCGGGCCTGGGGACTGGGG - Exonic
913239941 1:116821301-116821323 GGACATGGACCTGGGGACTGGGG - Intergenic
914992628 1:152511838-152511860 TGCCACAGCTCTGGGGGCTCTGG + Exonic
915097795 1:153475950-153475972 TGCCTCAGCCTTGGGGATTGGGG - Intergenic
918084945 1:181237423-181237445 TGCCTCAGCCCTAGGGACAGTGG - Intergenic
920167627 1:204046744-204046766 GGCCGAGGACCTGGGGACTGGGG + Intergenic
920173392 1:204085162-204085184 AGCCACTGCACTAGGGACTGGGG + Intronic
920598820 1:207301853-207301875 TGCCTGGGGACTGGGGACTGGGG + Intergenic
921157843 1:212452196-212452218 TCCCACTGCCCTTGGGACTCTGG - Intergenic
922533589 1:226363448-226363470 GGCCAGGGGTCTGGGGACTGTGG - Intronic
922573713 1:226648237-226648259 TGCCATGGTCCTGGGGGTTGCGG - Intronic
922721842 1:227903579-227903601 TGGCACTGCCCTGGGGTCTTAGG + Intergenic
922721917 1:227903780-227903802 TGGCCCCGCCCTGGGGTCTGGGG + Intergenic
924728033 1:246688126-246688148 TGCCTCAGCCCAGGAGACTGAGG - Intergenic
1062948261 10:1476825-1476847 TGCCACGGCCCTCTGGGGTGTGG + Intronic
1063368755 10:5507584-5507606 TGCAATGGCCAGGGGGACTGAGG + Intergenic
1063971928 10:11387217-11387239 TCCCACGGCGCTGGGGCCGGAGG + Intergenic
1064143139 10:12806863-12806885 TGCCAAGACCGTGGGGACTTTGG + Intronic
1065245343 10:23750660-23750682 AGCCAGGGTCCTGGGCACTGGGG - Intronic
1066661556 10:37741794-37741816 TGCCGGGACCCCGGGGACTGGGG + Intergenic
1070014744 10:72515163-72515185 TGCCATTGCACTGGGGACTTGGG + Intronic
1070516826 10:77215724-77215746 TGCCATAACACTGGGGACTGGGG - Intronic
1070758259 10:79006730-79006752 TGCCAGGGGCCAGGGGCCTGGGG - Intergenic
1072035560 10:91560376-91560398 TGCATCAGACCTGGGGACTGGGG + Intergenic
1072090182 10:92119520-92119542 GGCTTCTGCCCTGGGGACTGGGG + Intronic
1073441732 10:103556314-103556336 TCCCTGGGCCCTGGGAACTGGGG + Intronic
1074349750 10:112724650-112724672 TGCCCCAGCTCTGGGGTCTGAGG - Intronic
1074406011 10:113180908-113180930 AGCCAAAGCCCTGGGCACTGTGG - Intergenic
1074864938 10:117539483-117539505 TGCCAGGGCACTGGGCACTGTGG - Intergenic
1076526879 10:131117571-131117593 TGCCAAGGCCCCGGACACTGTGG + Intronic
1076646899 10:131959992-131960014 TGCCACTGCCTTGAGGTCTGCGG + Intergenic
1076760751 10:132604862-132604884 TGCAAAGGCCCTGGGGCCAGAGG + Intronic
1076765929 10:132633059-132633081 AGCCCCTGCCCTGGGGACAGAGG - Intronic
1076775671 10:132696810-132696832 TGGCCCGGCCCTGGGTGCTGTGG - Intronic
1076791214 10:132777795-132777817 TGCCCCAGCCCTGGGCACAGAGG + Intronic
1077138524 11:1013316-1013338 AGCCACGGCCCAGGGCACTTGGG + Exonic
1077155066 11:1087471-1087493 TGCACCAGCCATGGGGACTGAGG + Intergenic
1077311115 11:1889500-1889522 TGCCGCGGCTCTGGGCACGGAGG + Exonic
1077328529 11:1973928-1973950 GGCCAGGGCTCTGGGCACTGGGG + Intronic
1077377190 11:2210625-2210647 GACCTCGGCCCTGGGGTCTGAGG - Intergenic
1078932183 11:15921157-15921179 TGCCAGGGCCCTGAGTGCTGCGG - Intergenic
1081724001 11:45313734-45313756 TGCCAGCTCCCTGGGGACAGAGG + Intergenic
1083777731 11:64902439-64902461 TGCCATGGCCCTCGGGCCTGGGG - Intronic
1084447631 11:69212941-69212963 AGCCACGGAGCTGGGGGCTGGGG + Intergenic
1084499144 11:69524649-69524671 TGCCAAGGCGCTGGGGAGTGGGG + Intergenic
1084889665 11:72230484-72230506 GGCCAGGCCACTGGGGACTGCGG + Intronic
1085028551 11:73255644-73255666 TGCCACTGCACTCCGGACTGGGG - Intergenic
1085305875 11:75485892-75485914 TGCTAGGGCCCTGGGGAAGGGGG + Intronic
1085401694 11:76239582-76239604 TGCCAAGGCCCTGGGCACAGTGG - Intergenic
1086953940 11:92916607-92916629 TGGCTCTGCCCTGGGAACTGTGG + Intergenic
1089084471 11:115805397-115805419 TGCCCCTGCCCTGGGGACACTGG + Intergenic
1089437082 11:118478113-118478135 TGCCAGGTGCCTGAGGACTGTGG + Exonic
1089452929 11:118609841-118609863 TCCCTCGGCCCTGCGGACCGCGG + Intronic
1090226480 11:125074965-125074987 AACCAGGGACCTGGGGACTGGGG + Intronic
1090403826 11:126465684-126465706 AGCCACGGCCCTGGGCAGAGGGG + Intronic
1202811507 11_KI270721v1_random:29107-29129 GGCCAGGGCTCTGGGCACTGGGG + Intergenic
1091394194 12:143549-143571 CAGCACGGCCCTGGGGCCTGTGG - Intronic
1091596906 12:1884476-1884498 GCCCAGGGCCATGGGGACTGCGG + Intronic
1091652322 12:2319474-2319496 TGTCAGGGGCCTGGGGCCTGGGG - Intronic
1091995294 12:4988350-4988372 GGCCATGCCCCTGGGGAGTGAGG - Intergenic
1092237280 12:6818361-6818383 CTCCACGGGCCAGGGGACTGAGG - Intronic
1092333473 12:7606872-7606894 TGCCATGTGCCTGGGGCCTGGGG - Intergenic
1093093531 12:14947102-14947124 AGCCCAGGCCCTGGAGACTGAGG + Intronic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1095854198 12:46842533-46842555 TGTCATGGTCCTGGGAACTGGGG + Intergenic
1095943773 12:47742058-47742080 GGCCACTGCTCTAGGGACTGGGG - Intronic
1096396499 12:51270181-51270203 TGCCACGGCCGAGGTGGCTGCGG + Intronic
1096477952 12:51920230-51920252 TGGCTGGGCCCAGGGGACTGTGG - Intronic
1099510401 12:83528977-83528999 TGCCATGGTCCTGGGGCATGAGG + Intergenic
1100744611 12:97632160-97632182 TGCCAGGGAGCTGGGGAATGTGG - Intergenic
1101845566 12:108360576-108360598 GACCACCTCCCTGGGGACTGTGG + Intergenic
1102923906 12:116812417-116812439 TGCCACGCCCCAGGGACCTGCGG - Intronic
1103891357 12:124241433-124241455 TTACAGAGCCCTGGGGACTGCGG - Intronic
1104785309 12:131444819-131444841 AGCCATGGCCCTGGGGATGGGGG - Intergenic
1105849832 13:24323642-24323664 TCCCTCGGCCCTGGAGGCTGGGG - Intergenic
1106200207 13:27529738-27529760 TTACACCTCCCTGGGGACTGTGG + Intergenic
1107045135 13:35985658-35985680 AGCCTTGGCCCTTGGGACTGAGG + Intronic
1108444486 13:50493682-50493704 TGCAAGGGCCTTGGGGACAGAGG + Intronic
1111681327 13:91445514-91445536 TGCCACTGCCCTCGAGTCTGGGG - Intronic
1112363869 13:98740753-98740775 TGTCACTGCCCTGAGGACAGGGG + Intronic
1113610237 13:111639501-111639523 TGCCACAGGCCTGGGCTCTGAGG - Intronic
1113708448 13:112448778-112448800 CGCCACGTCCCTGGGGTCTCTGG - Intergenic
1113905363 13:113817061-113817083 TGCCCGGGCCCAGGGGACAGTGG + Intergenic
1114495321 14:23127887-23127909 TTCCAGGGCTCTGTGGACTGAGG + Intronic
1114532469 14:23404461-23404483 TGCCCTGGCCCTGAGGAATGGGG + Intronic
1119622870 14:76145945-76145967 TGTCAAGGCCCTGGGGAAGGTGG + Intergenic
1119890457 14:78178586-78178608 TGCAAGGGCCATGGGGAGTGTGG - Intergenic
1120054019 14:79900970-79900992 TGCCAAGGGCTTGGGGAGTGGGG - Intergenic
1121597132 14:95172706-95172728 TAAGACTGCCCTGGGGACTGGGG + Intergenic
1121954384 14:98200792-98200814 TGCCACGGCCATGGGAAGGGAGG + Intergenic
1122143986 14:99677932-99677954 GACCACTGACCTGGGGACTGTGG - Exonic
1122863890 14:104594900-104594922 TGGCAAGGCCCTGGGGTCTGGGG - Intronic
1122874214 14:104656062-104656084 TGCAAAGGCCCTGGGGAAGGAGG + Intergenic
1122885780 14:104709720-104709742 GGCCCAGGCCCTGGGGTCTGAGG - Intronic
1122982300 14:105197189-105197211 TGACCCCGCCCTGGGGTCTGGGG + Intergenic
1123014892 14:105368923-105368945 TGCCAAGCTCCTGGGGACCGTGG - Intronic
1123834801 15:24178290-24178312 TGCCACTGCCCTGCAGCCTGGGG + Intergenic
1124372589 15:29111943-29111965 GGCCAGGGCCCTTGGGACTGCGG - Intronic
1125557820 15:40601036-40601058 TTCCACGGCCCAGGGGGTTGGGG - Intronic
1128830291 15:70762906-70762928 AGCCCCGGCCCCGGGGACTGGGG + Intronic
1129199286 15:73989188-73989210 TGCCAGGTCCCTGGGGGGTGCGG + Exonic
1129363927 15:75042980-75043002 GGCCAAGGCGCTGGGGGCTGGGG - Intronic
1129893948 15:79090163-79090185 GGCCGCGGCCCTGGGGGCTCAGG - Intronic
1130472561 15:84237719-84237741 GGCCAGGGTCCTGGGGACAGGGG + Intronic
1130484279 15:84389865-84389887 GGCCAGGGTCCTGGGGACAGGGG + Intergenic
1130491717 15:84435839-84435861 GGCCAGGGTCCTGGGGACAGGGG - Intergenic
1130503332 15:84514879-84514901 GGCCAGGGTCCTGGGGACAGGGG - Intergenic
1131157703 15:90085089-90085111 TGGGCCGGCCCTGGGGACGGGGG + Exonic
1131755666 15:95558247-95558269 TGCCATGTCCCTGTAGACTGGGG - Intergenic
1132404715 15:101535421-101535443 TGCCACCACCCTGGGCCCTGTGG - Intergenic
1132470783 16:101764-101786 TGCCAGGGCCCTGAGCACAGCGG - Intronic
1132560367 16:590665-590687 TGCCATGGACCCGGGGTCTGGGG + Intronic
1132839930 16:1973994-1974016 GGGCGGGGCCCTGGGGACTGAGG + Intronic
1133173907 16:3999412-3999434 TCCCAGGGCCCTGGAGTCTGTGG - Intronic
1133225062 16:4337089-4337111 TGCCACAGGCCAGGGCACTGAGG - Exonic
1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG + Intronic
1135077219 16:19403850-19403872 TGCCAAGGTCATGGGGACTCGGG - Intergenic
1135481831 16:22827162-22827184 TGCAAAGGCCCTGAGGACAGAGG + Intronic
1135487477 16:22878843-22878865 TGCCAAGGCCCTGGGGTAGGCGG + Intronic
1136273039 16:29159580-29159602 TGACACGGCGCTGGCGACAGCGG - Intergenic
1136296371 16:29305858-29305880 TGCCAGGATCCTGGGGACTAGGG - Intergenic
1137666281 16:50251505-50251527 TCCCACGGCCCTGGCCTCTGCGG - Intronic
1137875680 16:51994567-51994589 TGCCATGGCCCAGGGCACAGTGG - Intergenic
1138487108 16:57352847-57352869 TGCCGAGTCCCTGGGGACTCAGG + Intergenic
1139444260 16:66987174-66987196 TGCCACATTCCTTGGGACTGAGG + Intergenic
1139519456 16:67472226-67472248 TGCCACTGCCCAGGGCAGTGGGG + Intronic
1140474930 16:75235050-75235072 GGCCACTGCCCCGGGGCCTGAGG - Exonic
1140482349 16:75268312-75268334 TGGCAAGGCCCTGGGGACAGAGG - Intergenic
1140599547 16:76458767-76458789 GTCCATGGCCCTGGGGATTGGGG + Intronic
1141203321 16:81913868-81913890 AGCCACCTCCCTGGGGACCGTGG + Intronic
1141523013 16:84593933-84593955 TGCCAGGGCCTGGGGGAATGGGG - Intronic
1142057965 16:88012003-88012025 TGCCAGGATCCTGGGGACTAGGG - Intronic
1142132832 16:88438657-88438679 TTCCACTGCCCTGGGAGCTGGGG - Exonic
1142233539 16:88910893-88910915 TGGCACAGCCCTGGAGGCTGGGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143268397 17:5657785-5657807 TGCTTCAGACCTGGGGACTGTGG - Intergenic
1143375417 17:6464202-6464224 TGCCGCGGCCCCGGCGCCTGGGG - Exonic
1143618858 17:8069719-8069741 TGACACTCCCCTGGGGCCTGAGG + Intergenic
1143723928 17:8832750-8832772 TCCCAGGAGCCTGGGGACTGGGG - Intronic
1146256267 17:31392789-31392811 TGCCACCGGCATGGGGACTGGGG + Intronic
1146630485 17:34465959-34465981 TGCCAAGGGCCTGGGGAGGGCGG - Intergenic
1148674567 17:49437915-49437937 TGCAAAGGCCCTGTGGCCTGTGG - Intronic
1151717925 17:75840814-75840836 TGCCAGGGACCTGGACACTGTGG - Exonic
1151978492 17:77495741-77495763 TGCCACGGCCCTGTGTAGGGCGG - Intronic
1152238467 17:79150218-79150240 AGCCACGTCCCAGGAGACTGAGG + Intronic
1152294289 17:79457595-79457617 TGCCACTGTCCTGGGGAGAGAGG - Intronic
1152686005 17:81694160-81694182 TGGTTCGGCCCTTGGGACTGAGG + Intronic
1152825421 17:82461861-82461883 TGCCAGTGCTGTGGGGACTGTGG + Intronic
1152943282 17:83184004-83184026 TGGCAGGGCCCTGGGGGCTGAGG + Intergenic
1203164108 17_GL000205v2_random:78294-78316 TGCCAAGGCCCTGACTACTGGGG - Intergenic
1153301733 18:3597643-3597665 TGCCACTGCCCTAGGAACAGAGG + Intronic
1154231162 18:12557401-12557423 AGCAACGGCCCTGGGCAGTGAGG - Intronic
1156088661 18:33440274-33440296 TCCCCCGGCAGTGGGGACTGGGG + Intronic
1156483350 18:37449798-37449820 TGCAAAGGCCCTGGGGCATGTGG + Intronic
1158520010 18:58164116-58164138 GGCCACAGCACAGGGGACTGAGG - Intronic
1158520295 18:58166798-58166820 GGCCACAGCACAGGGGACTGAGG - Intronic
1160265189 18:77335959-77335981 TGCCACACCCCAGGGGCCTGGGG - Intergenic
1160497847 18:79385546-79385568 TGCCCCGGCCTTGGGCAGTGAGG - Intergenic
1160846628 19:1168880-1168902 GGCCAAGGCCCTGGGTGCTGGGG - Intronic
1160877269 19:1302541-1302563 TGACCCGGCCCAGGGGACTGAGG + Intergenic
1160957401 19:1699896-1699918 TGCCACAGACCAGGGCACTGAGG - Intergenic
1160971081 19:1768054-1768076 CTCCAGGACCCTGGGGACTGAGG - Intronic
1161606856 19:5219862-5219884 GGTCAGGGCCCTGGGGAATGGGG + Intronic
1161999081 19:7731755-7731777 TGCCAGGGCCCTGGGGACGCTGG - Exonic
1162007085 19:7787864-7787886 TGCCAGGGCACTGGGGACGCTGG + Intergenic
1162129353 19:8516149-8516171 TGCCACTGCACTGCGGCCTGGGG - Intergenic
1162422678 19:10574804-10574826 TGACACAGGCCAGGGGACTGAGG + Intronic
1163275265 19:16279690-16279712 TGCCACGGCACTCGAGCCTGGGG + Intergenic
1163334502 19:16661775-16661797 GGCCACTGCGCTGGGGGCTGCGG + Intronic
1163743529 19:19031659-19031681 TGCCACTGCCCTCCAGACTGGGG + Intronic
1163872963 19:19839439-19839461 TGCCACTGCACTCCGGACTGGGG + Intergenic
1164418578 19:28067267-28067289 CACCATGGCCCTGGGGGCTGCGG - Intergenic
1164595821 19:29530159-29530181 TGCCGCGGCCTCGGGGACTGCGG - Exonic
1165192221 19:34074575-34074597 TGCCACTGCCCTCCAGACTGGGG - Intergenic
1165320147 19:35080149-35080171 TCCCACGGCCCTCATGACTGGGG + Intergenic
1166042965 19:40214209-40214231 GGCCATGGCCCTGGTGAGTGAGG + Exonic
1166114004 19:40641595-40641617 GGCGCAGGCCCTGGGGACTGTGG + Intergenic
1166572525 19:43806827-43806849 TTCCATGGACCTGGGGAGTGGGG - Intronic
1166751123 19:45164435-45164457 TGCCTGTGCCCTGGGGAGTGTGG + Intronic
1166938781 19:46350586-46350608 TCCCACAGCCCTGGAGCCTGGGG - Intronic
1166948875 19:46413358-46413380 AGCCGCGTCCCTGGGGCCTGGGG - Exonic
1166965624 19:46528117-46528139 TCCCACAGCCCTGGAGCCTGGGG + Intronic
1167516970 19:49929183-49929205 TGAGGCGGCCCCGGGGACTGGGG - Exonic
1167785005 19:51629433-51629455 TGCCATGGTCCTCGGGCCTGGGG + Exonic
1167787106 19:51645857-51645879 TGCCATGGTCCTCGGGCCTGGGG + Exonic
925001282 2:404718-404740 TGCCCCTGCCCTGGGATCTGTGG - Intergenic
925024399 2:596188-596210 AGGCAGGGCCCTGGGCACTGAGG + Intergenic
925339378 2:3125743-3125765 TGGCAGGGCCCAGGGGGCTGAGG - Intergenic
925686972 2:6482672-6482694 TGCCAGGGCCCTGGGGAGGCTGG + Intergenic
925893885 2:8456992-8457014 TTCTAGGGCCCTGGGGACTGGGG - Intergenic
926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG + Intergenic
927197937 2:20560848-20560870 TGACGCCTCCCTGGGGACTGTGG + Intronic
927545022 2:23944708-23944730 GGCTTCTGCCCTGGGGACTGGGG + Intronic
928179959 2:29062120-29062142 TGCCAAGGTGCTGGGGGCTGGGG - Exonic
930711788 2:54557221-54557243 TACAAGTGCCCTGGGGACTGAGG + Intronic
931719441 2:65056567-65056589 TGCCGCGGCGCTGGGGGCGGTGG + Intronic
932713132 2:74082371-74082393 TGCCATTGCTCTGGGGTCTGTGG + Intronic
932825219 2:74932884-74932906 TGCCTCAGCCCTGGGGATAGTGG + Intergenic
932834390 2:75021951-75021973 TGCTAGGGCCCTGTGGACTGTGG + Intergenic
933968905 2:87454051-87454073 TGCCACACCCCTGGGGCCTCAGG + Intergenic
935628841 2:105195193-105195215 TGCCTCGGCCCAGGAGATTGAGG + Intergenic
936324887 2:111496454-111496476 TGCCACGCCCCTGGGGCCTCAGG - Intergenic
937451713 2:122007701-122007723 TGCCTAGGCCATGGGGAGTGAGG + Intergenic
938765510 2:134458506-134458528 TGGAACTGTCCTGGGGACTGTGG - Intronic
941007538 2:160263103-160263125 TGCAGAGGCCCAGGGGACTGGGG + Intronic
942492290 2:176501550-176501572 TGCCACCACCCTGGAGACTGTGG + Intergenic
943736277 2:191358763-191358785 TGCCAAGGCCCTTGTGAGTGAGG - Intronic
946058609 2:216921794-216921816 TGCAAAGGCCCTGAGGCCTGAGG - Intergenic
947669791 2:231928913-231928935 GGCCATGCCCCTGGGGCCTGGGG - Intergenic
947792803 2:232877423-232877445 TCCAAAGGCCCTGGGGACTGGGG - Intronic
948663036 2:239518434-239518456 TGCAGCGGGCCTGGGGCCTGGGG + Intergenic
948910190 2:240998870-240998892 GGCCGCGGCCCTGGGGCTTGGGG + Exonic
949014738 2:241702626-241702648 CTCCCCGGCACTGGGGACTGCGG + Intronic
949048882 2:241886402-241886424 TCCCAGGTCCCTGGAGACTGAGG - Intergenic
1169737594 20:8853811-8853833 TGCCTCAGCACAGGGGACTGTGG - Intronic
1170773912 20:19358777-19358799 TGCCGGGGGCCTGGGAACTGGGG - Intronic
1170874839 20:20240698-20240720 TGACAAAACCCTGGGGACTGTGG + Intronic
1171179339 20:23081183-23081205 AGCCAGGGCCATGGGGACGGGGG - Exonic
1171371929 20:24668029-24668051 GGCCAAGCCCCTGGGAACTGAGG - Intergenic
1171402315 20:24882788-24882810 TGCCACAGGGCTGGGGGCTGGGG - Intergenic
1172005270 20:31815315-31815337 TGCCAAGGCCCTGGGCTCAGGGG + Intergenic
1172042526 20:32055830-32055852 TGCCAGGGGCCGGGGGAATGGGG - Intronic
1173327797 20:42049590-42049612 AGCTACTGCCCTGGGGAATGAGG - Intergenic
1173403930 20:42748694-42748716 TGCCAAAGCCCTGGGGAGCGGGG + Intronic
1174008378 20:47428576-47428598 TGCCACTGCCCTCCGGCCTGGGG - Intergenic
1174339001 20:49884428-49884450 TGCCGCAGCCATGGGGGCTGTGG + Intronic
1175789931 20:61734886-61734908 GGCCTCAGCCCTGGGGACTCAGG - Intronic
1175930185 20:62490179-62490201 TTCCACGCTCCTGGGGGCTGCGG + Intergenic
1175949858 20:62577637-62577659 TGCCCGGTCCCTGGGGACTGGGG + Intergenic
1176079137 20:63262896-63262918 AGCCCCAACCCTGGGGACTGGGG - Intronic
1176312550 21:5160509-5160531 GGCCACGGACCTGGGTACTAGGG + Intergenic
1178898023 21:36576673-36576695 TGCCACAGGCCTGGGATCTGGGG - Intergenic
1179844498 21:44101521-44101543 GGCCACGGACCTGGGTACTAGGG - Intronic
1180006106 21:45021431-45021453 GGCCACGGCCCTGGGGCTGGTGG + Intergenic
1180023995 21:45148227-45148249 TGCCATGGCCCTGAGGGCTTGGG - Intronic
1181670943 22:24425187-24425209 TGCCCCAGCCCTGGGGACCATGG + Intronic
1181771507 22:25129027-25129049 TGCCAGGGCCCTGGGTGCAGAGG + Intronic
1182580301 22:31304938-31304960 GGCCACAGCCCTGGGGTTTGGGG - Intergenic
1183191068 22:36322390-36322412 CGCCCCGGCTCTGGGGACAGAGG - Intronic
1183319915 22:37158847-37158869 TTCCACGGGCCTGGTGACTCAGG - Intronic
1183525689 22:38321191-38321213 TGCCAAGGCCCTGAGGCCAGAGG - Intronic
1183665097 22:39242456-39242478 GGCCGCGGCCCGGGGGGCTGCGG + Intronic
1184265705 22:43344746-43344768 TGGCACGGGCCTGGTGGCTGAGG + Intergenic
1184281570 22:43440481-43440503 TGCCAGGGCCTTGGGGTCAGTGG - Intronic
1184482357 22:44755271-44755293 AGCCACCTCCCTGGGCACTGAGG + Intronic
1184660826 22:45964782-45964804 TGGCACTGCCCTGAGCACTGAGG + Intronic
1185054182 22:48569475-48569497 TGCCAAGGACATGGGGAGTGTGG + Intronic
1185157496 22:49203069-49203091 TGCCCCTGACCTGGGGAGTGGGG - Intergenic
1185301608 22:50083932-50083954 TGCCTCGGAGCTGGGGACAGAGG - Intronic
1185416141 22:50711651-50711673 AGCCAAGGCCCTGGGGACACAGG - Intergenic
950165945 3:10799054-10799076 TGCCTAGGAGCTGGGGACTGGGG + Intergenic
950675846 3:14554008-14554030 TGTGACTGCCCTGGGGACAGTGG + Intergenic
953193843 3:40713765-40713787 TGCCAAGGCCCTGGAGGCGGAGG - Intergenic
953630356 3:44610352-44610374 TGCCAGGGTCTTGGGGAATGGGG + Intronic
954154035 3:48674827-48674849 GTCCACAGCCCTGGGGTCTGTGG - Intronic
954215875 3:49124270-49124292 TGGCACTGCCCTGTGAACTGGGG + Exonic
954292375 3:49656417-49656439 TGCCAAGGCCCCTGGGGCTGGGG + Exonic
954657692 3:52206704-52206726 TGCCACAATCTTGGGGACTGAGG - Exonic
954690278 3:52392006-52392028 TGCCACGAGCCTGGGCACTGTGG + Intronic
954708526 3:52493797-52493819 CCCCAAGGTCCTGGGGACTGAGG - Intergenic
955350334 3:58188938-58188960 TGCCAGGGTCTTGGGGACCGTGG + Intergenic
957403587 3:79749205-79749227 TGCCCCTGCCCTAGAGACTGTGG + Intronic
959051019 3:101525332-101525354 TGCCACTGCCCTAGGTTCTGTGG + Intergenic
961135096 3:124502702-124502724 GGTCACTGCCCAGGGGACTGTGG + Intronic
963554655 3:146772452-146772474 GGCCACCGCCCTGGGCAGTGAGG + Intergenic
966362784 3:179148402-179148424 TGCCGCGGCCGCTGGGACTGGGG + Intronic
966905236 3:184519204-184519226 TGCCACAGCCCTAGGGTCTAAGG - Intronic
967069417 3:185949707-185949729 TGCCACTACCCTGGGAATTGGGG + Intergenic
968618506 4:1593026-1593048 GCCCTCGGCCCTGGGCACTGGGG - Intergenic
970633473 4:17980691-17980713 GTCCATGGCCCTGGGGATTGGGG - Intronic
979619558 4:122783573-122783595 GGCGAGGGCCCTGGGTACTGAGG - Intergenic
982222962 4:153140605-153140627 TGCCGCATCCCGGGGGACTGAGG - Intergenic
985410316 4:189676638-189676660 TGCCACGTCCCTGCTGCCTGAGG + Intergenic
985675915 5:1231293-1231315 TCCCCCTGCCCTGGGGCCTGTGG + Intronic
986201057 5:5579078-5579100 TGCCATGGGTCTGGGGACAGAGG + Intergenic
987464029 5:18251296-18251318 TGCAACAGCCCTGAGGACTTTGG - Intergenic
990944028 5:61231264-61231286 TCCTGCGGCCCAGGGGACTGAGG - Intergenic
996281368 5:121732964-121732986 TCTCACAGCCCTGGGGAATGTGG - Intergenic
998567534 5:143229597-143229619 AGCCAGCGCTCTGGGGACTGAGG + Intergenic
999247704 5:150163969-150163991 AGTCAAGGCCCTGGGGAGTGGGG - Intergenic
999270430 5:150293705-150293727 TGCTTTGGCCCTGGGGAGTGGGG - Intergenic
999326630 5:150648233-150648255 TGTCGGGGCTCTGGGGACTGGGG - Exonic
1000919535 5:167121657-167121679 TGCTAAGAACCTGGGGACTGAGG - Intergenic
1001281265 5:170388023-170388045 GGCCATGGCCCTGGGCGCTGGGG - Intronic
1002589864 5:180283043-180283065 TTCCACAGCCCTCAGGACTGAGG - Intronic
1003114212 6:3272692-3272714 GGCCATGGCCCTGGTCACTGTGG + Exonic
1003645834 6:7912118-7912140 GGCCAAGGCCATGGGGACAGTGG - Intronic
1004351380 6:14893179-14893201 TGCCCTGGCCCTGGGGGCTGAGG + Intergenic
1004505111 6:16240852-16240874 AGCCACGGGCCTGGAGACTCAGG + Intronic
1004705616 6:18121742-18121764 CCCCCTGGCCCTGGGGACTGGGG - Exonic
1006147655 6:31969039-31969061 TGCCAGAGCCCTGGGGACGCTGG + Exonic
1006791513 6:36704211-36704233 TGCGTTGGCCCTGGGGACAGAGG - Exonic
1006980832 6:38146373-38146395 TTCCATGGCCCTCTGGACTGAGG - Intronic
1007479886 6:42142731-42142753 TGGCACGGCCCGGTGGGCTGGGG + Intergenic
1007510052 6:42367764-42367786 TGGCAGGGGCCTGGTGACTGAGG + Intronic
1007740609 6:44007262-44007284 AGGCACGGCTCTGGGCACTGAGG + Intergenic
1009298998 6:61991044-61991066 ATCCACGGCCCTGGGAACTCAGG - Intronic
1017169759 6:151445782-151445804 GGCCACGGCTCTGAGGAGTGTGG + Exonic
1018374805 6:163200939-163200961 TGCCTGGGGCCTGGGGCCTGGGG - Intronic
1018585106 6:165349395-165349417 TGCCCCTGCCCTAGGAACTGTGG + Intronic
1018812273 6:167306797-167306819 TGGCACAGCCCTGGGGCATGCGG + Intronic
1018961580 6:168453069-168453091 GGCCAAGGCCCTGGGGACTCTGG - Intronic
1019286971 7:228516-228538 TGACACTGCCATGGGGGCTGTGG + Exonic
1019421320 7:952595-952617 GGCCACAGCCCTGGGGAGCGGGG + Intronic
1019537890 7:1538438-1538460 TACCACGGCCCTGGCCGCTGCGG - Intronic
1019588415 7:1816821-1816843 TGCCACGGTCCTGGGCTGTGTGG + Intronic
1020076615 7:5262837-5262859 TACCATGGCCCTGGCAACTGTGG - Intergenic
1021926864 7:25542254-25542276 TGCCAAGGCCCTGGGGTGAGAGG - Intergenic
1022997116 7:35768539-35768561 TGCCAAGGCCCTGGCAGCTGGGG - Intergenic
1023031836 7:36096499-36096521 TGGCACAGCCATGGGGACTGGGG - Intergenic
1023142258 7:37113287-37113309 TGGCACTGCCCCGGGCACTGGGG + Intronic
1024118056 7:46211498-46211520 TGCCACAGCCCTGCGGCCTGGGG + Intergenic
1024994284 7:55260298-55260320 AGCATCGGCACTGGGGACTGCGG + Intergenic
1026808555 7:73443408-73443430 TGCCACAGCCTTGGGCTCTGTGG - Intronic
1027050533 7:75018772-75018794 TGCAAAGGCCCAGGGGCCTGAGG + Intronic
1027269923 7:76513572-76513594 TGCCACGGCCCAGGTGTCGGGGG + Intronic
1027998753 7:85464053-85464075 TGCCATGGGCCTGAGGTCTGTGG - Intergenic
1029223462 7:99008371-99008393 TGCCACAACCCGGGGCACTGGGG - Exonic
1029237478 7:99132958-99132980 TGCCAGGGTCCCAGGGACTGGGG + Intronic
1031064888 7:117094259-117094281 TACCGCAGCCCTGGGGCCTGAGG - Intronic
1031970256 7:128059890-128059912 TGCCCCAGCTGTGGGGACTGGGG + Intronic
1033200037 7:139360332-139360354 TGCCAGGGCCCTGGGGGTGGGGG + Intronic
1033417817 7:141179752-141179774 TCCCATGGCCCTCGGGACAGAGG - Intronic
1033732811 7:144195595-144195617 GGGGACGGCTCTGGGGACTGCGG - Exonic
1033743662 7:144294175-144294197 GGGGACGGCTCTGGGGACTGCGG - Intergenic
1033750240 7:144355422-144355444 GGGGACGGCTCTGGGGACTGCGG + Exonic
1034268595 7:149792688-149792710 TGCCACGGCACTGGCGACCTCGG - Intergenic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1034687743 7:152988231-152988253 TGTCAAGGTCCTGGGGACGGGGG + Intergenic
1035675119 8:1450688-1450710 TCCCAAGGCCCTGGGGACATAGG - Intergenic
1035702130 8:1644176-1644198 TGCCAGGCCCCTGGAGGCTGAGG - Intronic
1036370135 8:8155528-8155550 GGCCAAGGCCCTGGGGCTTGAGG - Intergenic
1036880757 8:12510103-12510125 GGCCAAGGCCCTGGGGCTTGAGG + Intergenic
1037803901 8:22049114-22049136 CGCCTCGGGCCTGGGGCCTGGGG - Intronic
1037986149 8:23291814-23291836 TGCCATGTCCCTTGAGACTGAGG - Intronic
1039058278 8:33553883-33553905 TGCCACGGGCTTGGGCACTGGGG + Intronic
1039568265 8:38566107-38566129 TGTCAGGGCTCTGGCGACTGTGG + Intergenic
1040074489 8:43215265-43215287 TACCAGGGCCTTGGGGAGTGAGG - Intergenic
1040294036 8:46140018-46140040 CGGGACGGCCCTGGGGACTTCGG + Intergenic
1040457877 8:47617940-47617962 TGTCACTGCCCTGAAGACTGGGG - Intronic
1041162703 8:55061245-55061267 TGCCAGGGACCAGGGCACTGGGG - Intergenic
1042769332 8:72362405-72362427 TGCCAGGGCCTGGGGGACGGGGG - Intergenic
1043388091 8:79767829-79767851 TCCCAGGGCCCTGGGGAGGGCGG + Exonic
1043519108 8:81025570-81025592 TACCATGGCCCTGGGCACGGTGG - Intronic
1044458652 8:92418483-92418505 TGCCAGGGATCTGGGGGCTGGGG + Intergenic
1044752189 8:95427012-95427034 TGCCAGGGCCCTGGGGGCAGGGG - Intergenic
1045910960 8:107409447-107409469 AGCCTGGGTCCTGGGGACTGTGG - Intronic
1048293655 8:133198845-133198867 TGCAAAGGCCCTGGGGCCTGAGG - Intronic
1049009586 8:139878578-139878600 TGCCACAGCCCTGAAGCCTGAGG - Intronic
1049222279 8:141433577-141433599 TCCCAGGGTCCTGGGGGCTGGGG - Intergenic
1049269561 8:141687083-141687105 TTCCCCGGCCCTGAGGAGTGGGG - Intergenic
1049345399 8:142136020-142136042 TGCCAAGGCCCTGGGGCAGGAGG - Intergenic
1049388429 8:142355805-142355827 TTCCCCGGCCCTAGGGACTTGGG - Intronic
1049432540 8:142571928-142571950 TGCAAAGGCCCAGTGGACTGTGG + Intergenic
1049686170 8:143940152-143940174 TGCCCTGGCCCTGGGGCCAGTGG + Intronic
1050243024 9:3658387-3658409 TGCTTGGGCTCTGGGGACTGGGG + Intergenic
1052913670 9:33906987-33907009 TGCCACTGCACTGGAGCCTGGGG + Intronic
1053130928 9:35615292-35615314 TGCCACGCCTAAGGGGACTGGGG - Intronic
1053295986 9:36913225-36913247 GACCTGGGCCCTGGGGACTGAGG - Intronic
1053464671 9:38297002-38297024 TGGCAGGGCTCTGGGGTCTGGGG + Intergenic
1055447017 9:76394052-76394074 TGACCCGGCCCGGGGGACTCTGG + Intronic
1056822188 9:89851076-89851098 TGCCCTGCCCCTGGGGTCTGTGG - Intergenic
1058544992 9:106051916-106051938 CGCCACAGCCCTGGGATCTGAGG + Intergenic
1058801122 9:108545291-108545313 TGCCACAGCTCTGTGCACTGTGG + Intergenic
1060364584 9:122997707-122997729 GGACAGAGCCCTGGGGACTGTGG - Intronic
1061167888 9:128934888-128934910 TGCCACAGCACTGGGGATAGGGG + Intronic
1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG + Exonic
1061484573 9:130913870-130913892 GGCCTCTGCCCTGGGGACTGGGG + Intronic
1062026641 9:134343699-134343721 TGCCACGGGCCTGGGGGCCTCGG + Intronic
1062255468 9:135618760-135618782 TGCCAGGGCCCTGTGCTCTGTGG - Intergenic
1062533573 9:137012034-137012056 AGCCCCGGCCGTGAGGACTGAGG - Intronic
1203672442 Un_KI270755v1:28842-28864 TGCCACGTCCCTGCTGCCTGAGG - Intergenic
1185433649 X:24482-24504 TGCCAGGGGCCGGGGGAATGGGG + Intergenic
1185442854 X:236550-236572 TGCCAGGGGCCGGGGGAATGGGG + Intergenic
1185636182 X:1553857-1553879 TACCATTGCCTTGGGGACTGAGG - Intergenic
1185696430 X:2198499-2198521 TGCCATTGCCTTGGGGACAGAGG - Intergenic
1187707556 X:22023361-22023383 TGGCACTGACCAGGGGACTGGGG - Intergenic
1189331400 X:40146787-40146809 TGCCAAGGCCCTGGGAACGGCGG - Intronic
1189398355 X:40643425-40643447 TGCCAGGGCTTTGGGGAATGAGG - Intronic
1190872446 X:54435588-54435610 TGACCCAGCCCTGGGGGCTGTGG - Intergenic
1192433856 X:71130218-71130240 GGCCAAGGCCGTGGGGGCTGTGG + Intronic
1192583361 X:72302411-72302433 TGCCATGGCTCTGAGCACTGAGG + Intronic
1192917325 X:75666494-75666516 TGCCACAGGCCTGGGGAAGGAGG - Intergenic
1200086886 X:153611419-153611441 TGCCCCGGCCCGGGGGGGTGGGG - Intergenic
1200121107 X:153791006-153791028 CGGGCCGGCCCTGGGGACTGAGG - Intronic
1202373809 Y:24215426-24215448 GGCCAGGGTCCTGGGGACAGGGG - Intergenic
1202496972 Y:25454694-25454716 GGCCAGGGTCCTGGGGACAGGGG + Intergenic