ID: 1061191462

View in Genome Browser
Species Human (GRCh38)
Location 9:129085086-129085108
Sequence CAGGAGCCACGGCCCTGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061191456_1061191462 23 Left 1061191456 9:129085040-129085062 CCTGGCACTGAACGAGGGGGTCA 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1061191462 9:129085086-129085108 CAGGAGCCACGGCCCTGTGGAGG 0: 1
1: 0
2: 0
3: 27
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061191462 Original CRISPR CAGGAGCCACGGCCCTGTGG AGG Exonic