ID: 1061193101

View in Genome Browser
Species Human (GRCh38)
Location 9:129093703-129093725
Sequence AGGTGTAGCCCAGACAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061193101_1061193103 -10 Left 1061193101 9:129093703-129093725 CCTCCATTGTCTGGGCTACACCT No data
Right 1061193103 9:129093716-129093738 GGCTACACCTCCTGTCCCCTTGG No data
1061193101_1061193112 6 Left 1061193101 9:129093703-129093725 CCTCCATTGTCTGGGCTACACCT No data
Right 1061193112 9:129093732-129093754 CCCTTGGGGCACTGGGCAAGTGG No data
1061193101_1061193104 -9 Left 1061193101 9:129093703-129093725 CCTCCATTGTCTGGGCTACACCT No data
Right 1061193104 9:129093717-129093739 GCTACACCTCCTGTCCCCTTGGG No data
1061193101_1061193108 -1 Left 1061193101 9:129093703-129093725 CCTCCATTGTCTGGGCTACACCT No data
Right 1061193108 9:129093725-129093747 TCCTGTCCCCTTGGGGCACTGGG No data
1061193101_1061193107 -2 Left 1061193101 9:129093703-129093725 CCTCCATTGTCTGGGCTACACCT No data
Right 1061193107 9:129093724-129093746 CTCCTGTCCCCTTGGGGCACTGG No data
1061193101_1061193105 -8 Left 1061193101 9:129093703-129093725 CCTCCATTGTCTGGGCTACACCT No data
Right 1061193105 9:129093718-129093740 CTACACCTCCTGTCCCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061193101 Original CRISPR AGGTGTAGCCCAGACAATGG AGG (reversed) Intergenic
No off target data available for this crispr