ID: 1061193129

View in Genome Browser
Species Human (GRCh38)
Location 9:129093832-129093854
Sequence AAGCGGGTAAAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061193129_1061193138 -2 Left 1061193129 9:129093832-129093854 CCAGCCTCCCTCTTTACCCGCTT No data
Right 1061193138 9:129093853-129093875 TTCCTTGTGGTCCTGAGGCTGGG No data
1061193129_1061193137 -3 Left 1061193129 9:129093832-129093854 CCAGCCTCCCTCTTTACCCGCTT No data
Right 1061193137 9:129093852-129093874 CTTCCTTGTGGTCCTGAGGCTGG No data
1061193129_1061193135 -7 Left 1061193129 9:129093832-129093854 CCAGCCTCCCTCTTTACCCGCTT No data
Right 1061193135 9:129093848-129093870 CCCGCTTCCTTGTGGTCCTGAGG No data
1061193129_1061193140 2 Left 1061193129 9:129093832-129093854 CCAGCCTCCCTCTTTACCCGCTT No data
Right 1061193140 9:129093857-129093879 TTGTGGTCCTGAGGCTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061193129 Original CRISPR AAGCGGGTAAAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr