ID: 1061194124

View in Genome Browser
Species Human (GRCh38)
Location 9:129098271-129098293
Sequence CCATCTGGATGAAGGCATCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061194116_1061194124 13 Left 1061194116 9:129098235-129098257 CCACAGAGGCGCACCTGTAGTAG 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1061194124 9:129098271-129098293 CCATCTGGATGAAGGCATCTGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1061194113_1061194124 27 Left 1061194113 9:129098221-129098243 CCTCCATGGGTGGGCCACAGAGG 0: 1
1: 0
2: 0
3: 18
4: 296
Right 1061194124 9:129098271-129098293 CCATCTGGATGAAGGCATCTGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1061194112_1061194124 30 Left 1061194112 9:129098218-129098240 CCTCCTCCATGGGTGGGCCACAG 0: 1
1: 0
2: 3
3: 30
4: 237
Right 1061194124 9:129098271-129098293 CCATCTGGATGAAGGCATCTGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1061194118_1061194124 0 Left 1061194118 9:129098248-129098270 CCTGTAGTAGGCCAGCTGCAAAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1061194124 9:129098271-129098293 CCATCTGGATGAAGGCATCTGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1061194115_1061194124 24 Left 1061194115 9:129098224-129098246 CCATGGGTGGGCCACAGAGGCGC 0: 1
1: 0
2: 2
3: 16
4: 172
Right 1061194124 9:129098271-129098293 CCATCTGGATGAAGGCATCTGGG 0: 1
1: 0
2: 3
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061194124 Original CRISPR CCATCTGGATGAAGGCATCT GGG Exonic