ID: 1061194201

View in Genome Browser
Species Human (GRCh38)
Location 9:129098620-129098642
Sequence CAGGGGAGACCGCACAAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061194193_1061194201 7 Left 1061194193 9:129098590-129098612 CCGCAGCTTCTTGGGCATGGGCA 0: 1
1: 0
2: 3
3: 28
4: 261
Right 1061194201 9:129098620-129098642 CAGGGGAGACCGCACAAGCTCGG 0: 1
1: 0
2: 0
3: 18
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061194201 Original CRISPR CAGGGGAGACCGCACAAGCT CGG Exonic