ID: 1061195345

View in Genome Browser
Species Human (GRCh38)
Location 9:129104150-129104172
Sequence TTGGGGGCCAGGAGGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 553}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061195345_1061195358 10 Left 1061195345 9:129104150-129104172 CCCGGCTGCCTCCTGGCCCCCAA 0: 1
1: 0
2: 6
3: 63
4: 553
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195345_1061195352 -5 Left 1061195345 9:129104150-129104172 CCCGGCTGCCTCCTGGCCCCCAA 0: 1
1: 0
2: 6
3: 63
4: 553
Right 1061195352 9:129104168-129104190 CCCAAACCCCAGCCACTCACCGG 0: 1
1: 0
2: 3
3: 30
4: 339
1061195345_1061195363 30 Left 1061195345 9:129104150-129104172 CCCGGCTGCCTCCTGGCCCCCAA 0: 1
1: 0
2: 6
3: 63
4: 553
Right 1061195363 9:129104203-129104225 AGGTCCACGAAGTCCTGCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1061195345_1061195362 29 Left 1061195345 9:129104150-129104172 CCCGGCTGCCTCCTGGCCCCCAA 0: 1
1: 0
2: 6
3: 63
4: 553
Right 1061195362 9:129104202-129104224 CAGGTCCACGAAGTCCTGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061195345 Original CRISPR TTGGGGGCCAGGAGGCAGCC GGG (reversed) Intronic