ID: 1061195347

View in Genome Browser
Species Human (GRCh38)
Location 9:129104158-129104180
Sequence GCTGGGGTTTGGGGGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 0, 2: 14, 3: 112, 4: 854}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061195347_1061195363 22 Left 1061195347 9:129104158-129104180 CCTCCTGGCCCCCAAACCCCAGC 0: 1
1: 0
2: 14
3: 112
4: 854
Right 1061195363 9:129104203-129104225 AGGTCCACGAAGTCCTGCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1061195347_1061195358 2 Left 1061195347 9:129104158-129104180 CCTCCTGGCCCCCAAACCCCAGC 0: 1
1: 0
2: 14
3: 112
4: 854
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195347_1061195362 21 Left 1061195347 9:129104158-129104180 CCTCCTGGCCCCCAAACCCCAGC 0: 1
1: 0
2: 14
3: 112
4: 854
Right 1061195362 9:129104202-129104224 CAGGTCCACGAAGTCCTGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061195347 Original CRISPR GCTGGGGTTTGGGGGCCAGG AGG (reversed) Intronic