ID: 1061195348

View in Genome Browser
Species Human (GRCh38)
Location 9:129104161-129104183
Sequence GTGGCTGGGGTTTGGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1019
Summary {0: 1, 1: 1, 2: 9, 3: 108, 4: 900}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061195348_1061195363 19 Left 1061195348 9:129104161-129104183 CCTGGCCCCCAAACCCCAGCCAC 0: 1
1: 1
2: 9
3: 108
4: 900
Right 1061195363 9:129104203-129104225 AGGTCCACGAAGTCCTGCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1061195348_1061195358 -1 Left 1061195348 9:129104161-129104183 CCTGGCCCCCAAACCCCAGCCAC 0: 1
1: 1
2: 9
3: 108
4: 900
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195348_1061195362 18 Left 1061195348 9:129104161-129104183 CCTGGCCCCCAAACCCCAGCCAC 0: 1
1: 1
2: 9
3: 108
4: 900
Right 1061195362 9:129104202-129104224 CAGGTCCACGAAGTCCTGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061195348 Original CRISPR GTGGCTGGGGTTTGGGGGCC AGG (reversed) Intronic