ID: 1061195350

View in Genome Browser
Species Human (GRCh38)
Location 9:129104167-129104189
Sequence CGGTGAGTGGCTGGGGTTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 347}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061195350_1061195367 29 Left 1061195350 9:129104167-129104189 CCCCAAACCCCAGCCACTCACCG 0: 1
1: 0
2: 0
3: 19
4: 347
Right 1061195367 9:129104219-129104241 GCTTGGGTAGCATCACGCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1061195350_1061195366 28 Left 1061195350 9:129104167-129104189 CCCCAAACCCCAGCCACTCACCG 0: 1
1: 0
2: 0
3: 19
4: 347
Right 1061195366 9:129104218-129104240 TGCTTGGGTAGCATCACGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1061195350_1061195358 -7 Left 1061195350 9:129104167-129104189 CCCCAAACCCCAGCCACTCACCG 0: 1
1: 0
2: 0
3: 19
4: 347
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195350_1061195363 13 Left 1061195350 9:129104167-129104189 CCCCAAACCCCAGCCACTCACCG 0: 1
1: 0
2: 0
3: 19
4: 347
Right 1061195363 9:129104203-129104225 AGGTCCACGAAGTCCTGCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1061195350_1061195362 12 Left 1061195350 9:129104167-129104189 CCCCAAACCCCAGCCACTCACCG 0: 1
1: 0
2: 0
3: 19
4: 347
Right 1061195362 9:129104202-129104224 CAGGTCCACGAAGTCCTGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061195350 Original CRISPR CGGTGAGTGGCTGGGGTTTG GGG (reversed) Exonic