ID: 1061195358

View in Genome Browser
Species Human (GRCh38)
Location 9:129104183-129104205
Sequence CTCACCGGAGCTGACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 149}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061195351_1061195358 -8 Left 1061195351 9:129104168-129104190 CCCAAACCCCAGCCACTCACCGG 0: 1
1: 0
2: 0
3: 21
4: 174
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195346_1061195358 9 Left 1061195346 9:129104151-129104173 CCGGCTGCCTCCTGGCCCCCAAA 0: 1
1: 0
2: 6
3: 59
4: 550
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195348_1061195358 -1 Left 1061195348 9:129104161-129104183 CCTGGCCCCCAAACCCCAGCCAC 0: 1
1: 1
2: 9
3: 108
4: 900
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195350_1061195358 -7 Left 1061195350 9:129104167-129104189 CCCCAAACCCCAGCCACTCACCG 0: 1
1: 0
2: 0
3: 19
4: 347
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195353_1061195358 -9 Left 1061195353 9:129104169-129104191 CCAAACCCCAGCCACTCACCGGA 0: 1
1: 0
2: 0
3: 8
4: 219
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195347_1061195358 2 Left 1061195347 9:129104158-129104180 CCTCCTGGCCCCCAAACCCCAGC 0: 1
1: 0
2: 14
3: 112
4: 854
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195349_1061195358 -6 Left 1061195349 9:129104166-129104188 CCCCCAAACCCCAGCCACTCACC 0: 1
1: 0
2: 7
3: 47
4: 586
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149
1061195345_1061195358 10 Left 1061195345 9:129104150-129104172 CCCGGCTGCCTCCTGGCCCCCAA 0: 1
1: 0
2: 6
3: 63
4: 553
Right 1061195358 9:129104183-129104205 CTCACCGGAGCTGACCCTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061195358 Original CRISPR CTCACCGGAGCTGACCCTGC AGG Exonic