ID: 1061196447

View in Genome Browser
Species Human (GRCh38)
Location 9:129109721-129109743
Sequence CTACGGGGCCAGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061196447_1061196457 26 Left 1061196447 9:129109721-129109743 CCCTCCGCCCTCTGGCCCCGTAG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1061196457 9:129109770-129109792 CAGCAACATATGCTTGGATCAGG No data
1061196447_1061196455 20 Left 1061196447 9:129109721-129109743 CCCTCCGCCCTCTGGCCCCGTAG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1061196455 9:129109764-129109786 AGACACCAGCAACATATGCTTGG No data
1061196447_1061196458 27 Left 1061196447 9:129109721-129109743 CCCTCCGCCCTCTGGCCCCGTAG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1061196458 9:129109771-129109793 AGCAACATATGCTTGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061196447 Original CRISPR CTACGGGGCCAGAGGGCGGA GGG (reversed) Intronic
902385539 1:16073527-16073549 CTGCGGAGCCAGAGGACGGGCGG + Exonic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904542044 1:31239744-31239766 CGGCGGGGCCAGCGCGCGGACGG - Intergenic
905983747 1:42256697-42256719 TTACTGGGTCAGAGGGCAGATGG - Intronic
907414069 1:54302024-54302046 CTACAGCTCCAGAGGGCGGCTGG + Intronic
909362582 1:74781027-74781049 GTAGGGGGTCAGAGGGCAGATGG + Intergenic
909737587 1:78982994-78983016 CTACGGGGGCAGAGGGAGAGTGG + Intronic
911083818 1:93959568-93959590 CTACGCAACCAGAGGGAGGAGGG - Intergenic
911108748 1:94161191-94161213 CTTCTGGGACAGAGGGTGGAGGG + Intronic
912857010 1:113178212-113178234 CTACGGGGGCAGACACCGGAAGG + Intergenic
917690292 1:177461694-177461716 CTAAGTGGCCTGAGGGCTGAAGG + Intergenic
918320793 1:183362422-183362444 CTGCAGGGCCAGGGGGCGGTGGG - Intronic
921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG + Intronic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
921384189 1:214552384-214552406 CTACGGGGCGGGAGGGGGCAGGG - Intronic
1067143180 10:43673257-43673279 ATACAGGGCCAGAAGGCAGAGGG - Intergenic
1069858722 10:71456890-71456912 CTTTGGGGCCAGAGGGCGATAGG - Intronic
1075124284 10:119687310-119687332 CTACGGGGTGAGAGGGGGGATGG - Intergenic
1076675695 10:132146465-132146487 CTACGGGTCCAGGGGCAGGAAGG + Intronic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077037259 11:501402-501424 CTAAGGAGACAGAGGGCTGAGGG + Intronic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1084568639 11:69945838-69945860 CCACGGGGGCAGAGGTGGGAGGG + Intergenic
1084887962 11:72223255-72223277 TTAAGGAGCCAGGGGGCGGAGGG + Intergenic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1088676501 11:112198740-112198762 CTAGGGGTCCAGAGGGCTGGAGG + Intronic
1099640788 12:85280664-85280686 CTTTGGGGGCGGAGGGCGGAGGG + Intronic
1100199062 12:92279160-92279182 CTATGGGGGCAGTGGGGGGAGGG - Intergenic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1102101247 12:110280903-110280925 CTCTGGGGCCGGTGGGCGGATGG - Intronic
1103385453 12:120528915-120528937 GAAAGGGGCGAGAGGGCGGATGG - Intronic
1105029619 12:132873728-132873750 CTACGGGGCTAGAGTGTGCACGG + Intronic
1105280994 13:18962520-18962542 CTGCGGAGCCTGAGGGCAGACGG + Intergenic
1114613008 14:24054327-24054349 CTACTGGGCCAGCTGGAGGAGGG + Intronic
1116143202 14:41027927-41027949 CTAAAGGGCCAGAGGACCGAAGG - Intergenic
1116550794 14:46235111-46235133 TTACAGGGCCAGAGTGCCGAGGG - Intergenic
1118341757 14:64899706-64899728 CTACAGGGCCAAATGCCGGAAGG - Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121277727 14:92679231-92679253 CTATGGGGCCAGAGGTGGGCTGG - Intronic
1122577711 14:102752304-102752326 CTAAGGGGCCAGTGGGTGGGAGG + Intergenic
1128639212 15:69323461-69323483 CTCCTGGGCCAGAGGCAGGATGG + Intronic
1129883914 15:79025632-79025654 CTGCAGGGCCAGATGGCTGAGGG + Intronic
1133201322 16:4206385-4206407 CCCCGGGGCCAGCGGGTGGAGGG - Intronic
1135060425 16:19266857-19266879 CTAGGGAGCCAGAGGGTTGAGGG - Intronic
1139506145 16:67399028-67399050 CTATGGGCTCAGAGGGCTGAGGG + Intronic
1139800963 16:69522291-69522313 ATACGGGGCCAGATGGGGGAAGG + Intergenic
1142146608 16:88495451-88495473 GTAGGGGGCCAGAGGAAGGACGG - Intronic
1143550978 17:7630324-7630346 CTACAGGGCCAGAGGAGAGAAGG - Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1145866701 17:28246516-28246538 CTACTGGGCCAGAGATGGGAGGG - Intergenic
1146535582 17:33647809-33647831 CTGCTGAGCCAGAGGGCTGAGGG + Intronic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1149993868 17:61397002-61397024 TGACGGGGCCGGAGGACGGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151894793 17:76972768-76972790 TTTCAGGGCCAGGGGGCGGAGGG - Intergenic
1153615234 18:6928147-6928169 CCACGGGGCCAGCGGGAGGTGGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158505679 18:58044433-58044455 CTGCGGGACCAGCGGGCGGGCGG - Exonic
1161277472 19:3426684-3426706 CGACGGGGAGAGAGGGAGGAGGG - Intronic
1161570085 19:5025668-5025690 CTAAGGCCCCAGAGGCCGGATGG - Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1165776658 19:38408681-38408703 CAAGGGGGCCAGAGAGCGAAGGG - Intronic
1165833979 19:38743555-38743577 CTCCGGGGTCTGAGGGAGGAGGG - Intronic
1166320628 19:42016482-42016504 CTCAGGGGCCAGAGGGTGCATGG - Intronic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166502675 19:43353403-43353425 CTCCTGGGTCTGAGGGCGGAGGG + Intergenic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166532712 19:43552476-43552498 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1166862391 19:45817871-45817893 CTCCGGGGTCAGACGGGGGAAGG + Intronic
1167322283 19:48804663-48804685 CCGCGGGTCCAGGGGGCGGAAGG - Intronic
1167432225 19:49461441-49461463 CTCCGGGGTCTGAGGGAGGAGGG + Intronic
1167441782 19:49513101-49513123 CTCCGGGGTCTGAGGGAGGAGGG + Intronic
1167495899 19:49818630-49818652 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1167600496 19:50451715-50451737 CTACTGGGTCTGAGGGAGGAGGG + Intronic
1167618387 19:50548517-50548539 ATGCGGGGCCAGCGGGCAGAGGG - Intronic
1167678850 19:50906834-50906856 CTCCTGGGCCTGAGGGAGGAGGG + Exonic
1167689143 19:50974956-50974978 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167690877 19:50983181-50983203 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1167738300 19:51310675-51310697 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1168056595 19:53868147-53868169 CTCCGGGGTCTGAGGGAGGAGGG + Intronic
1168057086 19:53869861-53869883 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057103 19:53869898-53869920 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057174 19:53870054-53870076 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057262 19:53870272-53870294 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057279 19:53870309-53870331 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168107245 19:54172611-54172633 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1168238167 19:55076292-55076314 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1168325927 19:55538181-55538203 CTCCTGGGCCTGAGGGTGGAGGG + Intergenic
1168325941 19:55538219-55538241 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
928006911 2:27570733-27570755 CTCCAGGGCCAGAGGGGGAAGGG + Intergenic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
929994235 2:46815300-46815322 CTACGTTGCCAGATGGCTGAGGG + Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
934640020 2:96022365-96022387 CTAAGGGGCCAGAGGTCTCAAGG - Intronic
934793628 2:97083031-97083053 CTAAGGGGCCAGAGGTCTCAAGG + Intergenic
935946166 2:108288641-108288663 CTTCGAGGCCAGTGGGAGGAGGG + Exonic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
938408667 2:131046438-131046460 ACACAGGTCCAGAGGGCGGATGG - Exonic
946555270 2:220849377-220849399 CTACAGGGCTAGAGGGTGGAGGG + Intergenic
948353094 2:237356981-237357003 ATAAGGGGCAAGAGGGCTGAGGG - Intronic
1169117007 20:3072296-3072318 CTCCGGGGCCAGGGGGAGGCGGG + Intronic
1171248501 20:23632122-23632144 CCATGGGGCCACCGGGCGGAGGG + Intronic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1173686085 20:44924330-44924352 CTGCTGGGCGAGAGGGTGGAGGG - Intronic
1174182367 20:48682894-48682916 TTACAGGGCCAGAGGGGGGCAGG + Intronic
1175127137 20:56760736-56760758 CTAAGGGGCCAGAGGGGGCGGGG + Intergenic
1176304929 21:5118345-5118367 CTCCGGGCCCAGCGGGGGGAGGG - Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1176366118 21:6033928-6033950 CTCCGGGGCAGGCGGGCGGATGG + Intergenic
1179603528 21:42496759-42496781 CTGCGAGGCCTGGGGGCGGAAGG - Intronic
1179757399 21:43504617-43504639 CTCCGGGGCAGGCGGGCGGATGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179852125 21:44143685-44143707 CTCCGGGCCCAGCGGGGGGAGGG + Intronic
1181067946 22:20315480-20315502 CCATGGGGCCAGGGCGCGGAGGG + Intronic
1184229661 22:43151756-43151778 CTACCGGGTCAGGGGGCGGCGGG + Intronic
953854289 3:46489076-46489098 CTTCGGGGCCACAGGGCAGGCGG - Intergenic
955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG + Intronic
968443100 4:634359-634381 CGACGTGGCCGGAGGGCGGCAGG + Intronic
969112277 4:4851540-4851562 CTACCGGGCCAGAGTGCTGCAGG + Intergenic
969399251 4:6943059-6943081 CGATGGGGCCACAGGACGGAAGG - Intronic
985616829 5:927553-927575 CTGCGGGGGCAAAGGCCGGAAGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
1002901036 6:1409975-1409997 CTAAGGGGCCCGAGGCCGAAAGG - Intergenic
1008215416 6:48782460-48782482 CGCCGGGGCCAGGGGGTGGAGGG + Intergenic
1015211990 6:130708912-130708934 TTCAGGGGCCAGAGGGTGGAGGG + Intergenic
1017506712 6:155075060-155075082 GTACAGGGCCAGAGGGCAGTGGG + Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1035657299 8:1319781-1319803 GTAAGGGGCCAGAGACCGGAAGG + Intergenic
1036590519 8:10163854-10163876 CGACTGGGGCAAAGGGCGGAGGG - Intronic
1037450736 8:19013827-19013849 CCCCGGGGGCGGAGGGCGGAGGG + Intronic
1038637643 8:29300504-29300526 ATACGGGGGCAGGGGGAGGAGGG - Intergenic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1041219439 8:55634026-55634048 CCATGGGGCCAAAGGGAGGATGG - Intergenic
1042785085 8:72537364-72537386 CCGCGGGGGCGGAGGGCGGAGGG - Intergenic
1044625769 8:94234281-94234303 CTGAAGCGCCAGAGGGCGGATGG - Intergenic
1045793307 8:106012144-106012166 CTATGCTGCCAGAGGGCTGATGG + Intergenic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1049879374 8:145051950-145051972 CTACGGCGCAAGAGGGTGGTCGG - Intergenic
1050201748 9:3152135-3152157 ACACGGGGCCAGGGGGTGGATGG + Intergenic
1059684865 9:116625448-116625470 CAATGGGGCCAGAGTGGGGAGGG - Intronic
1060282330 9:122222857-122222879 CAACGGGGCAAGGGGGAGGAAGG - Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061205208 9:129159049-129159071 CAACTGGAACAGAGGGCGGATGG - Intergenic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061716332 9:132520778-132520800 CTCCTGGGCCAGGGGGCAGAAGG - Intronic
1062606046 9:137349306-137349328 CTCCCGGGACAGAGGGCGGGAGG + Intronic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1186511764 X:10134994-10135016 TTTCTGGGCCAGAGGGTGGATGG + Intronic
1186561599 X:10619123-10619145 CGAGGGGGCAAGAAGGCGGAGGG + Intronic
1198215308 X:134549737-134549759 CTCCGGGGCCCGGGGGCGGAAGG + Intergenic
1198394129 X:136206184-136206206 CCGCGGGGCCAGATGGCCGATGG - Intronic