ID: 1061200779

View in Genome Browser
Species Human (GRCh38)
Location 9:129137351-129137373
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4079
Summary {0: 1, 1: 3, 2: 44, 3: 602, 4: 3429}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061200779 Original CRISPR CAGTTTCCTCACCTGGACAC TGG (reversed) Intronic
Too many off-targets to display for this crispr