ID: 1061201010

View in Genome Browser
Species Human (GRCh38)
Location 9:129138586-129138608
Sequence GTCGGGAAAGGGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061201010_1061201019 8 Left 1061201010 9:129138586-129138608 CCCTCCTCAGTCCCTTTCCCGAC 0: 1
1: 0
2: 2
3: 35
4: 314
Right 1061201019 9:129138617-129138639 GGATGTCTGCTGCCTCAGTGAGG No data
1061201010_1061201020 19 Left 1061201010 9:129138586-129138608 CCCTCCTCAGTCCCTTTCCCGAC 0: 1
1: 0
2: 2
3: 35
4: 314
Right 1061201020 9:129138628-129138650 GCCTCAGTGAGGTTCCTAGCAGG No data
1061201010_1061201022 26 Left 1061201010 9:129138586-129138608 CCCTCCTCAGTCCCTTTCCCGAC 0: 1
1: 0
2: 2
3: 35
4: 314
Right 1061201022 9:129138635-129138657 TGAGGTTCCTAGCAGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061201010 Original CRISPR GTCGGGAAAGGGACTGAGGA GGG (reversed) Intronic
900192188 1:1356338-1356360 GTGGGGAAGGGGACTCAGTAGGG + Intronic
900626818 1:3612073-3612095 GTCGGGGAAGGGCTTGAGGAGGG + Intergenic
903123222 1:21230336-21230358 GTTGGGAAAGGGAGGGATGAGGG - Intronic
903249385 1:22041533-22041555 ATTGGGAGAGGGCCTGAGGAAGG - Intergenic
905204266 1:36334081-36334103 TACTTGAAAGGGACTGAGGAAGG - Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
906224035 1:44106281-44106303 GTTGGGAAAGAATCTGAGGATGG - Intergenic
907412933 1:54295107-54295129 GTCAAGTGAGGGACTGAGGAAGG - Intronic
907455425 1:54572422-54572444 GTAGGGCAGGGGTCTGAGGAGGG + Intronic
909405022 1:75279198-75279220 GGCTGGAAAGGGAATGAGGGAGG - Intronic
909473368 1:76054621-76054643 GTGGGGAAATTGACTGGGGAAGG + Intergenic
910036875 1:82799339-82799361 ATCAGGAAAGAAACTGAGGAAGG - Intergenic
912517306 1:110224538-110224560 GGATGGAAAGGAACTGAGGAAGG + Intronic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
914912528 1:151799390-151799412 GTCGGAGGAGGGACTGAGAAGGG - Intergenic
915472527 1:156134620-156134642 CTAGGGCAAGGGACTCAGGAAGG - Intronic
915504882 1:156347959-156347981 GTCTGGAAAGGGGCTGGGCACGG + Intronic
915580124 1:156808538-156808560 GATGGGGAAGGGTCTGAGGAGGG + Intronic
916213484 1:162376719-162376741 GTCGGGAAAAGCACTCAGGGCGG + Exonic
917133326 1:171763992-171764014 GACAGGAAAGGGAGTGAGTAGGG + Intergenic
917675090 1:177311328-177311350 GGAGGGAAAGGGGCTGGGGAGGG + Intergenic
919669287 1:200324242-200324264 GTGTGGGAAGGGACTGAGCATGG + Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
921875315 1:220189087-220189109 GAAGGGAATGGGACTGAGGGGGG + Intronic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
923634568 1:235682211-235682233 GTCGGGGATGGGGCTGAGGTGGG + Intronic
924037128 1:239949192-239949214 GTTGGGGGAGGGACTGAGAATGG - Intergenic
924276622 1:242395281-242395303 GTAGGGGAAGGGAATAAGGAAGG - Intronic
1063390266 10:5645712-5645734 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063390394 10:5646368-5646390 TTGGGCAAAGGGACTGGGGAGGG + Intronic
1063685071 10:8229141-8229163 GTGTGGAAAGGCACTGTGGAAGG + Intergenic
1064696281 10:17968932-17968954 GTTGGGAAATGTACTGAGGGAGG - Intronic
1065327565 10:24562689-24562711 ATGGGGAAAGGAACTGAAGATGG - Intergenic
1067098040 10:43315190-43315212 GGCGGGAGGGGGGCTGAGGAGGG + Intergenic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068227693 10:54127571-54127593 GTCTAGAAATGGAGTGAGGAAGG + Intronic
1069409283 10:68135940-68135962 GTTGGGATAGGGACTTTGGAAGG + Intronic
1069851686 10:71409460-71409482 GTTGGGTAAGGGACGGAGGATGG + Intronic
1070653158 10:78252465-78252487 GCCGGGAAAGGGATTGAGGAGGG - Intergenic
1073127818 10:101162884-101162906 GTCAGAAAAGGGACAGGGGAGGG + Intergenic
1073147797 10:101292009-101292031 GGTGGGAGAGGGAGTGAGGACGG - Intergenic
1074151649 10:110764638-110764660 GTCTGGAAAGGGGCAGCGGAGGG - Intronic
1075616142 10:123891899-123891921 GCCGGGAAAGGGAGGGAAGAAGG - Intronic
1076564097 10:131386498-131386520 GCAGGGAGAGGGACTGAGGGTGG + Intergenic
1076760938 10:132605419-132605441 GATGGGAAAGGGGCTGGGGATGG + Intronic
1078178669 11:8990863-8990885 GTTGGGAGTGGGACTGAGAAGGG - Intronic
1078241277 11:9532764-9532786 GTCAGGAACTGGAATGAGGAAGG - Intergenic
1082958273 11:58895108-58895130 TTCAGGGAAGGGACAGAGGAGGG - Intronic
1085381399 11:76122422-76122444 ATAGGGAAAGGGATTGAGGCAGG - Intronic
1085399893 11:76229671-76229693 GGAGGGAAGGAGACTGAGGAGGG + Intergenic
1085654718 11:78303039-78303061 CTCGGGAAAGGGTGAGAGGAGGG + Intronic
1087836242 11:102878165-102878187 GTTGGTAAAGGGAATGAGAAGGG - Intergenic
1088471986 11:110196649-110196671 GTTGGGAAGGGGCCTGAGGTGGG - Intronic
1089560427 11:119340657-119340679 GAGGGGAAAGGGGCTGGGGAGGG - Intronic
1090386502 11:126360250-126360272 GTCATGCAAGGGACTGACGAGGG + Intronic
1091112354 11:132981484-132981506 GGCGGGAAAGGGCCTGAGGGAGG + Intronic
1091821089 12:3475699-3475721 GTCCTGAAAGGGCCTGAGCAGGG + Intronic
1091901442 12:4147299-4147321 GGCAGGCATGGGACTGAGGAAGG - Intergenic
1093163500 12:15777778-15777800 GTTGGGAAAGGGGGTGATGAAGG + Intronic
1095432475 12:42148907-42148929 GTAGGGAAAGAGTCAGAGGAAGG + Intergenic
1096625486 12:52892873-52892895 GTCGGGAAAGGCAGGGTGGAGGG + Intergenic
1096628779 12:52912142-52912164 TGAGGGAAAGGGACTGAGGGCGG + Intronic
1097024241 12:56042358-56042380 GGCCGGAAAGGGACTGAGGCTGG + Intronic
1097069363 12:56343589-56343611 GCAGGGAAAGGGAGGGAGGATGG + Intronic
1097439522 12:59592661-59592683 GCAGGGAAAGGGAGTGATGAAGG + Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100431655 12:94536264-94536286 AGAGGGAAAGGGACTGAGGCCGG - Intergenic
1100671411 12:96816969-96816991 GTCGGGAATGGGAGTGAAGAGGG - Intronic
1100694812 12:97081135-97081157 ATCAGGAAATGGACTGAGCATGG - Intergenic
1101925637 12:108969283-108969305 GTAGGGAGAGAGAGTGAGGAAGG - Intronic
1102554702 12:113719257-113719279 GTTGGGGAAGGGACTGGGCATGG + Intergenic
1104319735 12:127739531-127739553 GTCAGGAAATGGAGTCAGGAGGG + Intergenic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104873467 12:132016905-132016927 GTCGGGAGAGAGACTCAGGAAGG - Intronic
1105675080 13:22662340-22662362 TTCGGGGAGGGGACAGAGGACGG + Intergenic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1105978358 13:25493800-25493822 GTCAGGAAAAGGAGTGTGGAGGG + Intronic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108794768 13:54017812-54017834 GGAGGGAAAGGGAGGGAGGAAGG + Intergenic
1108794786 13:54017857-54017879 GGAGGGAAAGGGAGGGAGGAAGG + Intergenic
1109742427 13:66572372-66572394 GGCTGGCAAGTGACTGAGGAGGG - Intronic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1112541499 13:100318059-100318081 TACGGAAAAGGGACTGAGGAAGG - Intronic
1113867381 13:113535909-113535931 GTCTGGGGAGGGACTGGGGATGG + Intronic
1114250649 14:20957295-20957317 GTCGGGAAGGGGTCAGTGGATGG - Intergenic
1114639066 14:24206944-24206966 GTAGGGAGAGAGACAGAGGATGG - Intronic
1114697624 14:24642530-24642552 GCTGGGAAAGGGATAGAGGAAGG - Intergenic
1114727161 14:24950884-24950906 GTCGGGAAGGGGACTGGGGGAGG - Intronic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1120708079 14:87765284-87765306 GTGGGGAGAGGGACAGAGGGAGG + Intergenic
1120887000 14:89459675-89459697 GTGGGCCAAGGGAGTGAGGAAGG - Intronic
1120944574 14:89982124-89982146 GTGGGGCAAGGGAGTGGGGAGGG - Intronic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122830758 14:104394505-104394527 GCAGGGAAAGGGGCTGGGGACGG - Intergenic
1123475974 15:20592797-20592819 GTCAGGAAAGGGTCTGGGGAGGG + Intergenic
1123642037 15:22407566-22407588 GTCAGGAAAGGGTCTGGGGAGGG - Intergenic
1124635450 15:31361866-31361888 GTAGGGAAAGGGACACAGTATGG - Intronic
1125379449 15:39071809-39071831 GTTGGGAAAGGGACTTGGGTTGG + Intergenic
1125530498 15:40410180-40410202 GTCTGCAAAAGGCCTGAGGAAGG - Intronic
1126377005 15:48006830-48006852 GGTGGGAAAGGGGGTGAGGAGGG + Intergenic
1126867745 15:52954702-52954724 CTCTGGAAAGAGACTGGGGAAGG - Intergenic
1129231359 15:74198920-74198942 GTGGAGAAAGGGAGTGAGGCAGG + Intronic
1129257519 15:74342492-74342514 GTCTGGAAAGGGGAGGAGGAAGG + Intronic
1129333341 15:74838751-74838773 GCAGGGAAAGGGCCTGAGGAGGG + Intronic
1130927824 15:88398442-88398464 GCTGGGAGAGGGGCTGAGGAAGG - Intergenic
1131612458 15:93979320-93979342 GTCTGGAAAGGGAGTAAAGATGG + Intergenic
1131624122 15:94099964-94099986 GTGTGGCAAGGAACTGAGGAAGG + Intergenic
1132532970 16:462710-462732 GCTGGGGAAGGGACTGGGGAAGG - Intronic
1132630081 16:913067-913089 AACGGGAAAGGCACTGAGGCGGG - Intronic
1132711671 16:1271623-1271645 GTGGGTAAAGGGCCTGGGGACGG + Intergenic
1133032561 16:3018184-3018206 GTCGGGACAGGGGCGGAGGCGGG + Exonic
1133265319 16:4579940-4579962 GCCGGGAAGGGGCCTGAGGGAGG - Intronic
1133534789 16:6691429-6691451 GATGGTAAAGGTACTGAGGAAGG - Intronic
1133668115 16:7990709-7990731 GTTGGGAACGGCAGTGAGGAAGG - Intergenic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135981836 16:27153870-27153892 GTAGGGAAAGAGAATAAGGAGGG + Intergenic
1136014270 16:27385090-27385112 CTAGGGAAAGGAACTGAGAATGG + Intergenic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1138245244 16:55462561-55462583 CCCAGGAAGGGGACTGAGGAGGG - Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1142848945 17:2695142-2695164 GTCGGGAAAGAGCCTGAGGTGGG - Intronic
1142870209 17:2814940-2814962 CTCGGGAACGGGACTTGGGAGGG + Intronic
1143194116 17:5062530-5062552 GCCGGGAAAGTGGATGAGGAAGG - Intergenic
1144278791 17:13703335-13703357 GCGGGGAGAGGGAGTGAGGAAGG + Intergenic
1144629421 17:16862941-16862963 TTCAGGAAAGGGACTGAGGGAGG + Intergenic
1144652006 17:17013175-17013197 TTCAGGAAAGGGACTGAGGGAGG - Intergenic
1145077976 17:19870792-19870814 GCCAGGAATGGGACTGAGGAAGG + Intergenic
1145160994 17:20573507-20573529 TTCAGGAAAGGGACTGAGGGAGG + Intergenic
1145741316 17:27277040-27277062 GTCAGGAAAGGCAGTCAGGAAGG - Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1147160803 17:38568474-38568496 GTGGGAAAAGGCACAGAGGATGG + Intronic
1148615222 17:48996343-48996365 GGCGGGAGAGGGACGGAGGGCGG - Intergenic
1148808798 17:50277841-50277863 GGCTGGATTGGGACTGAGGACGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1150002539 17:61451091-61451113 ATCTGGAAAGGGACAGAGGCTGG + Intergenic
1150603038 17:66667115-66667137 GTGGGGGAAGGGACTGGGCAGGG - Intronic
1151899565 17:77002750-77002772 GTCGGGAGATGCACAGAGGAGGG + Intergenic
1151993763 17:77595867-77595889 GGCAGCAAAGGGACTGAGCAGGG + Intergenic
1152271160 17:79325695-79325717 GTAGGGAAAGGGAGAGAGGGAGG - Intronic
1153070088 18:1095670-1095692 CTCTGGTAGGGGACTGAGGAAGG + Intergenic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1156940038 18:42756003-42756025 CTCGGTAAAGGGACTAAGAAAGG + Intronic
1157440806 18:47710287-47710309 CTAGGGAAAGGGGCTGATGACGG + Intergenic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1162474528 19:10892009-10892031 GGCGGGGAAGGGACAGAGGGAGG - Intronic
1164470488 19:28526131-28526153 GTCGTGAAAGGAACTGTGAAAGG + Intergenic
1164851547 19:31488510-31488532 GTAAGGAAAGGGGATGAGGAAGG - Intergenic
1165066485 19:33232143-33232165 TTGGGGATAGGAACTGAGGAGGG + Intergenic
1165436249 19:35797068-35797090 GACGGGAACGGGATTTAGGAGGG + Intergenic
1165974240 19:39660595-39660617 GTAGGGGAAGGGGTTGAGGAGGG - Exonic
1166045158 19:40225656-40225678 GTCGAGTAAGGGGCTGGGGAAGG - Intronic
1166670634 19:44707728-44707750 GCTGGGAAGGAGACTGAGGAAGG - Intronic
1166996291 19:46721172-46721194 GGCGGGAAAGGTCCTGAGGCAGG + Intronic
1167255223 19:48423606-48423628 GTGTGCAAAGGGCCTGAGGAAGG + Intronic
1167744382 19:51342055-51342077 GACAGGGAAGGGACTGAGCAGGG + Intronic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168296152 19:55378147-55378169 GAGGGGGAAGGGACGGAGGAGGG + Exonic
925156373 2:1651573-1651595 GGCTGGAAAGGGGGTGAGGAAGG - Intronic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
928371492 2:30743113-30743135 GTGGCAAGAGGGACTGAGGAAGG - Intronic
929356669 2:41033166-41033188 GTCATTAAATGGACTGAGGATGG - Intergenic
929616155 2:43310206-43310228 GGCGGGAAAGGGAGGGAGGGAGG - Intronic
931266868 2:60668270-60668292 ATTGGGAAAGGGACTGGGCATGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932316777 2:70790130-70790152 GTCTGGGAGGGGACAGAGGAGGG - Intronic
933326069 2:80839098-80839120 GTTGGGGATGGGAGTGAGGATGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
936605350 2:113946863-113946885 GTCTGGAAGGGAACCGAGGAGGG + Intronic
937062477 2:118990861-118990883 GATGGCAAAGGGGCTGAGGATGG + Intronic
937270117 2:120644293-120644315 GAGGGGAAAGGAACTGAGTAGGG - Intergenic
938136294 2:128760329-128760351 GGCGGGAAAGGGTCAGGGGAGGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
941179466 2:162240806-162240828 GGCAGGAAAGGGAAGGAGGAAGG - Intronic
941995751 2:171600624-171600646 CCCAGGAAAGGGACGGAGGAAGG + Intergenic
946305404 2:218854212-218854234 GTTGGGAAAGGGGGTGAGAAAGG - Intergenic
947224134 2:227823930-227823952 TTGGGAAAAGGGACAGAGGATGG + Intergenic
948311979 2:236994127-236994149 GTCGGGAAAGGGGTGGGGGAGGG - Intergenic
1170059460 20:12244318-12244340 GTTGAGAAAGGCACTGAGGCTGG + Intergenic
1171333698 20:24363546-24363568 TTCGGGACAGAGAATGAGGATGG + Intergenic
1172181083 20:33004023-33004045 GCCGGGAAATGCACAGAGGACGG - Intronic
1172658229 20:36549669-36549691 GTAGGGAAGGGGACTGAGAGGGG - Exonic
1172696352 20:36825758-36825780 GTCAGGAAAGAGACGGAGGAGGG + Intronic
1173913271 20:46686876-46686898 GTTGGGATGGGTACTGAGGAAGG + Exonic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174514695 20:51082852-51082874 GTCGGGAAGGGGAGAGTGGAGGG + Intergenic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1176264859 20:64203806-64203828 GTCTGGATAGAGACTGGGGATGG + Intronic
1176270389 20:64233154-64233176 GGAGGGAAAGGGAAGGAGGAAGG - Intronic
1179469331 21:41600143-41600165 GAAGGTAAAGGGACTGACGAGGG - Intergenic
1179576244 21:42310211-42310233 GAAAGGAAAGGGGCTGAGGAGGG - Intergenic
1179656842 21:42851029-42851051 GTTGGGAGAGGGACCGGGGAGGG - Intronic
1181438692 22:22924779-22924801 CTCGGGAAAGGGGCTGTGGTCGG - Intergenic
1181496112 22:23288431-23288453 ATCTGGAAAGGGCCTGGGGAAGG - Intronic
1182668091 22:31973522-31973544 GTTGGGATAGGTACTGGGGAAGG + Intergenic
1182870226 22:33639919-33639941 GAGGGCAAAGGGACTGATGAGGG + Intronic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183346589 22:37311589-37311611 GTGGGGAGAGGGCCTGAGGCTGG + Intronic
1184263498 22:43333256-43333278 GCCGGGAAAGGCTCTGAGCAGGG - Intronic
1184870823 22:47237435-47237457 GAAGGGAGAGGGAGTGAGGATGG + Intergenic
1185094963 22:48801060-48801082 GTTGGGCCAGGGACTGAGGAGGG + Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
951597561 3:24334701-24334723 TTCTGGAAAGGGGCTCAGGAGGG + Intronic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
953827303 3:46264970-46264992 GCCAGGAAAAGGATTGAGGAAGG - Intronic
954374144 3:50185366-50185388 GTGGGGGAAGGGGCTGAGGCTGG + Intronic
954437010 3:50501620-50501642 GCAGGGAAAGGGAGTGAGGTCGG + Intronic
954748291 3:52799342-52799364 GTGGGGAGAGGGACGGAGGCCGG - Intronic
954963859 3:54592616-54592638 GTAGGGGAAGAGAGTGAGGAAGG + Intronic
955198808 3:56830855-56830877 GTCAGGAAAGACTCTGAGGAGGG - Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
958721009 3:97843443-97843465 GTGGGGAAAGGCTCTGAGAAGGG + Intronic
959398179 3:105868356-105868378 GCCGGGAAGGGGCCTGAGCAGGG - Intronic
961622146 3:128232567-128232589 GGGGGGAAGGGGACTGAGGCGGG + Intronic
962282163 3:134060224-134060246 GTTGGGAGAGGCACGGAGGAGGG + Intergenic
962426225 3:135271428-135271450 GTGGGGAAAGGCAATGAGGCTGG - Intergenic
963084171 3:141421682-141421704 GTGGGGTGAGGGGCTGAGGACGG - Intronic
966562832 3:181342601-181342623 GTGGGGCAAGGTACTGAGGTGGG - Intergenic
966781007 3:183584193-183584215 GTGGGACAAGGGACTCAGGAAGG - Intergenic
968280936 3:197476256-197476278 GGAAGGAAAAGGACTGAGGATGG - Intergenic
969481315 4:7448539-7448561 GTAGAGAAAGGGAGGGAGGAAGG - Intronic
969582964 4:8076489-8076511 GTAGGGAGGGGCACTGAGGAAGG - Intronic
969604299 4:8194716-8194738 ATCAGGAAAGGGACAGAGGACGG + Intronic
970187286 4:13470907-13470929 GGGGGCAAAGGGACTGAAGAGGG + Intronic
970298509 4:14657450-14657472 GGTGAGAAAGGGAGTGAGGAGGG - Intergenic
973656543 4:53054086-53054108 GCCGGAAAAGGTAGTGAGGAGGG - Intronic
973774519 4:54231881-54231903 CTCGGGACGCGGACTGAGGAGGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975707255 4:77123261-77123283 GTCCAGAAAGGTAATGAGGATGG + Intergenic
976471740 4:85436750-85436772 GTCGGGGTAGGGACAGGGGAGGG + Intergenic
981159758 4:141483949-141483971 GTGGGGAAGGGGACTGCAGAGGG - Intergenic
981937798 4:150253589-150253611 GGCGTGAGAGGGGCTGAGGATGG - Intronic
982130445 4:152224351-152224373 TGCGGGAAAGGGCCTGAGGCTGG + Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
984938345 4:184909447-184909469 GTTGGGAAAAAGACTGAGGCAGG - Intergenic
984941580 4:184936754-184936776 GTCGGACTAGGGACAGAGGATGG + Intergenic
985622095 5:961102-961124 GTCAGGAAAGAGACGGAGAAGGG - Intergenic
985731580 5:1552294-1552316 CTCGGGAGAGGGACTGAGAGGGG + Intergenic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
986867431 5:12006478-12006500 GAGGGGGAAGGGAGTGAGGAAGG - Intergenic
986878877 5:12145347-12145369 GTTGGGAAAGGTACAGAGGTTGG + Intergenic
987423210 5:17745325-17745347 GTAGAGAAAGGAACTGAGAAGGG - Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
990598447 5:57333752-57333774 CTATGCAAAGGGACTGAGGAGGG + Intergenic
992496739 5:77301103-77301125 GTCGGGAAAGTGAGTGTGGTTGG + Intronic
992738388 5:79746831-79746853 GTCAGGACAGGGATGGAGGATGG - Intronic
994100303 5:95884084-95884106 GTGGGAGAAGGGACTGGGGAGGG + Intergenic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
996755657 5:126932471-126932493 CTCAGGAAAGGGACAGAGGTGGG + Intronic
998537801 5:142950964-142950986 GAAGGGAAAGGGAAAGAGGAAGG - Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002053576 5:176585725-176585747 GCAGGGAAGGGGACTGAGCATGG + Intronic
1003175625 6:3751022-3751044 GGCGGGAAAGGGGCCGAGGCCGG - Intronic
1003378668 6:5602805-5602827 GTGCCAAAAGGGACTGAGGAGGG - Intronic
1004758959 6:18644696-18644718 GTCATAAAAGGAACTGAGGAGGG + Intergenic
1005618015 6:27594008-27594030 GTCGGGAAAGAGAGTGGGGAAGG - Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1007104110 6:39271680-39271702 GGCGGGAAAGGAAATCAGGAAGG - Intergenic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007521104 6:42452285-42452307 GGAGGGAGAGGGACCGAGGAGGG + Intergenic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008630809 6:53361368-53361390 GTATGGAAAGGGCCTGAGGCAGG - Intergenic
1010981504 6:82375156-82375178 GTGTGGCATGGGACTGAGGAGGG + Intergenic
1011839400 6:91477871-91477893 GTCGTGAAAGGGACTGGTGTAGG - Intergenic
1018275331 6:162124372-162124394 GCTGGGAAAGGGACAGAGCAGGG + Intronic
1018893946 6:168000562-168000584 GTCGGCAATGGGAGTGGGGAGGG - Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1022082977 7:27042508-27042530 GTAGGGGAAGAGAATGAGGACGG - Intergenic
1022851665 7:34269237-34269259 ATTTGGAAAGGGAGTGAGGAAGG + Intergenic
1023152323 7:37213700-37213722 CGCTGGAAAGGGACTGATGATGG + Intronic
1023749529 7:43358444-43358466 ATCGAGAAAGTGACTCAGGAAGG + Intronic
1024242951 7:47449374-47449396 GTAGGGACAGGGAGTGAGGGAGG - Intronic
1024295833 7:47841327-47841349 CTCGGGAGAGGTACTGAGGAGGG - Intronic
1026736747 7:72953877-72953899 GTGGGGAAAGGGTCTAAGGCTGG - Intergenic
1027106987 7:75411186-75411208 GTGGGGAAAGGGTCTAAGGCTGG + Intergenic
1027224914 7:76237758-76237780 GAAGGGAGAGGGGCTGAGGATGG - Intronic
1027915143 7:84308610-84308632 GTCGGGAAGGGGCCAGAGGTTGG + Intronic
1029166611 7:98595906-98595928 TTCCAGACAGGGACTGAGGATGG + Intergenic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029647982 7:101869987-101870009 GTCAGAAAAGGCACTGGGGAGGG - Intronic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032390034 7:131549886-131549908 GTCGGGGAAGGGGGTGGGGATGG + Intronic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033511645 7:142065479-142065501 GTCGGCAAAGGCCCTGGGGAAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035025503 7:155822356-155822378 GGTGGGAAAGGCACAGAGGAGGG - Intergenic
1035063997 7:156092137-156092159 GTCTGGAAAGGGCCTTAGGGTGG - Intergenic
1035516705 8:239805-239827 TTTGGGAAAGGGACAGAGGCTGG - Intronic
1035758607 8:2052654-2052676 GTCTGGAAAGGGACTGAGCTTGG - Intronic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1042722113 8:71837373-71837395 GCTGGGAAAGGTAGTGAGGAGGG + Intronic
1043179499 8:77068933-77068955 GTCTGGGAAGGGTCTGAGGGAGG - Intergenic
1044561712 8:93618569-93618591 GAAGGGAAAGAGACTGAGGTTGG + Intergenic
1045743498 8:105388668-105388690 GTCTTGAAAGGGAGTGAGGATGG + Intronic
1047414536 8:124653130-124653152 GATGGGAAAGAAACTGAGGAAGG + Intronic
1048070262 8:131013362-131013384 GTAGGGTAAGGGAAGGAGGAAGG + Intronic
1048931972 8:139322458-139322480 GTTGAGAAAGGGACTCTGGAGGG - Intergenic
1049602595 8:143514880-143514902 GACAGGGAGGGGACTGAGGAGGG - Intronic
1051184448 9:14443532-14443554 GCTTAGAAAGGGACTGAGGATGG - Intergenic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1052090080 9:24317018-24317040 GTAGAGAAAGGGAGTGAAGAGGG + Intergenic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053284455 9:36841354-36841376 GTGGGGAAAGGCACAGAGGCAGG - Intronic
1053606797 9:39668240-39668262 GTCTGGAACTGCACTGAGGATGG + Intergenic
1053946374 9:43312960-43312982 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1054246739 9:62674162-62674184 GTCTGGAACTGCACTGAGGATGG - Intergenic
1054560860 9:66708696-66708718 GTCTGGAACTGCACTGAGGATGG - Intergenic
1054869989 9:70040353-70040375 GCAGGGAAAAAGACTGAGGAGGG - Intergenic
1056767867 9:89455730-89455752 GTCTGGAAAGTGAGGGAGGAAGG - Intronic
1057353226 9:94317223-94317245 ATCAGGAGAGGGACTGAGGCTGG - Intergenic
1057654524 9:96940368-96940390 ATCAGGAGAGGGACTGAGGCTGG + Intronic
1059336902 9:113574787-113574809 GGTGGGAAGGGGAGTGAGGATGG + Intronic
1059675035 9:116529773-116529795 GGCAGGAAAGAGAGTGAGGAGGG - Intronic
1060227971 9:121807731-121807753 GTGGGGCAAGGGACAGGGGACGG + Intergenic
1060601089 9:124878124-124878146 TTCTGAAGAGGGACTGAGGAGGG - Intergenic
1061005590 9:127927215-127927237 GCCGGGACAGGGAGTGAGGGAGG + Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061515216 9:131085777-131085799 GTCGGGAAGGGGCCCGCGGAAGG - Intronic
1062559739 9:137136194-137136216 GTCAGGACAGGGAGAGAGGAGGG + Intergenic
1203589504 Un_KI270747v1:41518-41540 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1186056753 X:5657327-5657349 GGCAGGAAAGGGACTGGGGGAGG + Intergenic
1187317122 X:18206660-18206682 GTCGGGAAGGGGTCAGAAGAAGG + Intronic
1187866557 X:23728164-23728186 GTTGGGAAAGGGTCTGAAAAAGG - Intronic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1190923029 X:54875058-54875080 TTAGGGAAAGGGTCTAAGGAAGG - Intergenic
1192043234 X:67644950-67644972 GTCAGAAAAGGAAATGAGGATGG + Intronic
1192275795 X:69629707-69629729 GGAGGGAAAGGAACTGAGGAAGG - Intronic
1192360689 X:70436863-70436885 GTAAGGAAGGGGCCTGAGGAGGG + Intergenic
1192546882 X:72021706-72021728 GTCAGGGATGGGACTGAGGCTGG + Intergenic
1196047714 X:111273691-111273713 ATCAGGGAAGAGACTGAGGATGG + Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1196856272 X:119988255-119988277 GTCAGGGATGGTACTGAGGATGG + Intergenic
1196904465 X:120418361-120418383 GACTGGAAAGGGACTTGGGATGG - Intergenic
1198780708 X:140232699-140232721 GTTGGGAAGGGTACTGGGGAGGG - Intergenic
1200168852 X:154057387-154057409 TTCTGGAAAGGGTATGAGGAAGG - Intronic
1200306263 X:155028895-155028917 GGCGGGCAAGGGAAAGAGGAGGG - Intronic