ID: 1061201109

View in Genome Browser
Species Human (GRCh38)
Location 9:129139022-129139044
Sequence CAGGATAAGCTGGAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061201103_1061201109 -10 Left 1061201103 9:129139009-129139031 CCCTGGGGGACCTCAGGATAAGC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061201109 Original CRISPR CAGGATAAGCTGGAGGAGCA GGG Intronic
No off target data available for this crispr