ID: 1061202205

View in Genome Browser
Species Human (GRCh38)
Location 9:129144367-129144389
Sequence CACAGCGCCGGCCTCAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061202205_1061202215 5 Left 1061202205 9:129144367-129144389 CCCTAGTTGAGGCCGGCGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1061202215 9:129144395-129144417 AAGGGGACAGGCTCCTGTATAGG No data
1061202205_1061202216 6 Left 1061202205 9:129144367-129144389 CCCTAGTTGAGGCCGGCGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1061202216 9:129144396-129144418 AGGGGACAGGCTCCTGTATAGGG No data
1061202205_1061202214 -7 Left 1061202205 9:129144367-129144389 CCCTAGTTGAGGCCGGCGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG No data
1061202205_1061202217 15 Left 1061202205 9:129144367-129144389 CCCTAGTTGAGGCCGGCGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1061202217 9:129144405-129144427 GCTCCTGTATAGGGTGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061202205 Original CRISPR CACAGCGCCGGCCTCAACTA GGG (reversed) Intronic
900171969 1:1273710-1273732 CCCTGCTCCGGCCTCGACTACGG - Exonic
900678162 1:3901200-3901222 CCCACCGACGGCCTCCACTAAGG - Intergenic
901640452 1:10690505-10690527 GACAGCCCAGGCCTCAACTGTGG - Intronic
911707007 1:101025788-101025810 CACGCCGCCGGCCTCACCTACGG + Intronic
913534702 1:119759907-119759929 CACAGCTCCGGCCCCACCTGTGG + Exonic
917755419 1:178093864-178093886 CACAGCTCCGGCCACAGCTCTGG - Intergenic
1073917579 10:108424377-108424399 CAGTGAGCCTGCCTCAACTATGG + Intergenic
1077250044 11:1556966-1556988 CACAGCCTCGGCCTGAACTTCGG - Exonic
1084944905 11:72633184-72633206 CACAGCCCTGGCCTGGACTAGGG - Intronic
1100726693 12:97416620-97416642 AGCAGCGCTGGCCTCACCTAGGG + Intergenic
1101640681 12:106583995-106584017 CCCAACGCCGGGCTCCACTAGGG + Intronic
1103968633 12:124655774-124655796 CAAAGCCCCGGCCTCAGCTGGGG - Intergenic
1122280892 14:100621940-100621962 CACACCCCCAGCCCCAACTAGGG + Intergenic
1125883877 15:43214293-43214315 CACAGCTCCAGCCACAGCTAGGG + Intronic
1126907078 15:53379360-53379382 CACAGGGCAAACCTCAACTATGG - Intergenic
1142860426 17:2757510-2757532 CACAGCGCCTGGCTCAAGTATGG + Intergenic
1143581578 17:7830727-7830749 CTCATTGCCGGCATCAACTATGG + Exonic
1148764185 17:50027865-50027887 CACAGAGCAAGCCTCAACAAAGG + Intergenic
1156584179 18:38413702-38413724 CCCAGCGCAGGCCTGAACTCTGG + Intergenic
1157404925 18:47414664-47414686 CCCAGGGCCAGCCTCAACTGTGG - Intergenic
1163437397 19:17303536-17303558 CCCAGAGCCCGCCTCCACTACGG - Intronic
1163658620 19:18562917-18562939 CACAGGGCAGGCCTGAATTAGGG - Intronic
1164546981 19:29174044-29174066 CACAGCACTGGCCTCACCCAAGG - Intergenic
1168315008 19:55481226-55481248 CATGGCGCCGGCCTCTACTGCGG + Exonic
945461661 2:210116441-210116463 CACAGCACTGGTCTCACCTAAGG - Intronic
948625484 2:239265656-239265678 CACAGCGCCGGCACCAACACAGG + Intronic
948909751 2:240997128-240997150 CCGAGAGCCGGCCTCAAGTAGGG + Intergenic
1173227496 20:41170393-41170415 CACAGCCCCTGCCTTAGCTAGGG + Intronic
1175912379 20:62411010-62411032 CACAGCTCCGGCCTGACCTCCGG - Intronic
1184225443 22:43126953-43126975 CCCAGGGCCGGCCTCAGCTCAGG + Intronic
1184890283 22:47375082-47375104 CCCAGCCCCGGCCACAACGATGG + Intergenic
1184994865 22:48198194-48198216 CACAGCGCAAGCCTCCACTGTGG + Intergenic
968660522 4:1796972-1796994 CACAGTGCCGACCTCAACTTGGG - Intronic
985895565 5:2748615-2748637 CGCCGCGCCGGCCTCAACCGGGG - Exonic
990580078 5:57159760-57159782 CACTGCGCCGGCCTAAAAAAAGG - Intergenic
998974452 5:147628769-147628791 CACAGTGCTGGCCTGAATTATGG + Exonic
1024643163 7:51348494-51348516 CACACCCCCGGCCTGCACTAAGG - Intergenic
1042003624 8:64155538-64155560 CACCGCCCCGGCCTCTTCTAAGG + Intergenic
1048048614 8:130796361-130796383 CACAGCCCCTGCCTCAATAAAGG - Intronic
1057094536 9:92293893-92293915 CACAGCGCCGCCCTCAGCGCTGG - Intergenic
1060897783 9:127229399-127229421 AACAGCGCCTGCCTCAATTGTGG + Intronic
1061202205 9:129144367-129144389 CACAGCGCCGGCCTCAACTAGGG - Intronic
1185642678 X:1597291-1597313 CACTGCACCTGCCTCACCTAAGG - Intronic
1188238263 X:27754698-27754720 CACAGCTCAGGCCACAACTCTGG - Intergenic