ID: 1061202214

View in Genome Browser
Species Human (GRCh38)
Location 9:129144383-129144405
Sequence CGCTGTGTGGGGAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061202206_1061202214 -8 Left 1061202206 9:129144368-129144390 CCTAGTTGAGGCCGGCGCTGTGT 0: 1
1: 0
2: 1
3: 4
4: 52
Right 1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG No data
1061202205_1061202214 -7 Left 1061202205 9:129144367-129144389 CCCTAGTTGAGGCCGGCGCTGTG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061202214 Original CRISPR CGCTGTGTGGGGAAGGGGAC AGG Intronic
No off target data available for this crispr