ID: 1061202587

View in Genome Browser
Species Human (GRCh38)
Location 9:129146247-129146269
Sequence CAGGCCCAGGATCCTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061202583_1061202587 -7 Left 1061202583 9:129146231-129146253 CCCGCATTCTGTGTCTCAGGCCC 0: 1
1: 2
2: 1
3: 27
4: 271
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202569_1061202587 29 Left 1061202569 9:129146195-129146217 CCCCTCCCGCCCAGGGACCACCT 0: 1
1: 1
2: 0
3: 25
4: 328
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202573_1061202587 23 Left 1061202573 9:129146201-129146223 CCGCCCAGGGACCACCTCCCGCT 0: 1
1: 0
2: 1
3: 25
4: 284
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202581_1061202587 -1 Left 1061202581 9:129146225-129146247 CCTGCTCCCGCATTCTGTGTCTC 0: 1
1: 0
2: 2
3: 22
4: 245
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202578_1061202587 6 Left 1061202578 9:129146218-129146240 CCCGCTCCCTGCTCCCGCATTCT 0: 1
1: 0
2: 0
3: 43
4: 461
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202577_1061202587 9 Left 1061202577 9:129146215-129146237 CCTCCCGCTCCCTGCTCCCGCAT 0: 1
1: 0
2: 2
3: 35
4: 413
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202571_1061202587 27 Left 1061202571 9:129146197-129146219 CCTCCCGCCCAGGGACCACCTCC 0: 1
1: 0
2: 1
3: 41
4: 435
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202572_1061202587 24 Left 1061202572 9:129146200-129146222 CCCGCCCAGGGACCACCTCCCGC 0: 1
1: 0
2: 1
3: 36
4: 419
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202579_1061202587 5 Left 1061202579 9:129146219-129146241 CCGCTCCCTGCTCCCGCATTCTG 0: 1
1: 0
2: 3
3: 52
4: 510
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202574_1061202587 20 Left 1061202574 9:129146204-129146226 CCCAGGGACCACCTCCCGCTCCC 0: 1
1: 0
2: 4
3: 47
4: 311
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202584_1061202587 -8 Left 1061202584 9:129146232-129146254 CCGCATTCTGTGTCTCAGGCCCA 0: 1
1: 0
2: 2
3: 24
4: 302
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202568_1061202587 30 Left 1061202568 9:129146194-129146216 CCCCCTCCCGCCCAGGGACCACC 0: 1
1: 0
2: 2
3: 65
4: 530
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202575_1061202587 19 Left 1061202575 9:129146205-129146227 CCAGGGACCACCTCCCGCTCCCT 0: 1
1: 0
2: 3
3: 59
4: 449
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202580_1061202587 0 Left 1061202580 9:129146224-129146246 CCCTGCTCCCGCATTCTGTGTCT 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202576_1061202587 12 Left 1061202576 9:129146212-129146234 CCACCTCCCGCTCCCTGCTCCCG 0: 1
1: 1
2: 12
3: 178
4: 1289
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data
1061202570_1061202587 28 Left 1061202570 9:129146196-129146218 CCCTCCCGCCCAGGGACCACCTC 0: 1
1: 0
2: 3
3: 22
4: 317
Right 1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061202587 Original CRISPR CAGGCCCAGGATCCTGGCTG TGG Intronic
No off target data available for this crispr