ID: 1061203746

View in Genome Browser
Species Human (GRCh38)
Location 9:129151471-129151493
Sequence GTAAGCTGGAAGTTTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061203746_1061203752 13 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203752 9:129151507-129151529 AGATGGAGAACTAGTTGCAAAGG No data
1061203746_1061203751 -4 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203751 9:129151490-129151512 TTACTGGGGAAACAGAGAGATGG No data
1061203746_1061203754 17 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203754 9:129151511-129151533 GGAGAACTAGTTGCAAAGGAGGG No data
1061203746_1061203753 16 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203753 9:129151510-129151532 TGGAGAACTAGTTGCAAAGGAGG No data
1061203746_1061203755 20 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203755 9:129151514-129151536 GAACTAGTTGCAAAGGAGGGCGG No data
1061203746_1061203756 24 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061203746 Original CRISPR GTAAGCTGGAAGTTTCTTGA AGG (reversed) Intergenic
No off target data available for this crispr