ID: 1061203750

View in Genome Browser
Species Human (GRCh38)
Location 9:129151485-129151507
Sequence TCTCTGTTTCCCCAGTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061203750_1061203753 2 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203753 9:129151510-129151532 TGGAGAACTAGTTGCAAAGGAGG No data
1061203750_1061203758 22 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203758 9:129151530-129151552 AGGGCGGAAGGTGATGCGGCCGG No data
1061203750_1061203757 18 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203757 9:129151526-129151548 AAGGAGGGCGGAAGGTGATGCGG No data
1061203750_1061203760 26 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203760 9:129151534-129151556 CGGAAGGTGATGCGGCCGGGTGG No data
1061203750_1061203756 10 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG No data
1061203750_1061203752 -1 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203752 9:129151507-129151529 AGATGGAGAACTAGTTGCAAAGG No data
1061203750_1061203755 6 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203755 9:129151514-129151536 GAACTAGTTGCAAAGGAGGGCGG No data
1061203750_1061203754 3 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203754 9:129151511-129151533 GGAGAACTAGTTGCAAAGGAGGG No data
1061203750_1061203759 23 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203759 9:129151531-129151553 GGGCGGAAGGTGATGCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061203750 Original CRISPR TCTCTGTTTCCCCAGTAAGC TGG (reversed) Intergenic
No off target data available for this crispr