ID: 1061203756

View in Genome Browser
Species Human (GRCh38)
Location 9:129151518-129151540
Sequence TAGTTGCAAAGGAGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061203746_1061203756 24 Left 1061203746 9:129151471-129151493 CCTTCAAGAAACTTCCAGCTTAC No data
Right 1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG No data
1061203750_1061203756 10 Left 1061203750 9:129151485-129151507 CCAGCTTACTGGGGAAACAGAGA No data
Right 1061203756 9:129151518-129151540 TAGTTGCAAAGGAGGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061203756 Original CRISPR TAGTTGCAAAGGAGGGCGGA AGG Intergenic
No off target data available for this crispr