ID: 1061204019

View in Genome Browser
Species Human (GRCh38)
Location 9:129152698-129152720
Sequence GACCCCGGTGTCCCTACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061204019_1061204030 15 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204030 9:129152736-129152758 CAGCCAGCTGGTTAGAATTTGGG No data
1061204019_1061204033 19 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204033 9:129152740-129152762 CAGCTGGTTAGAATTTGGGGTGG No data
1061204019_1061204034 23 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204034 9:129152744-129152766 TGGTTAGAATTTGGGGTGGTAGG No data
1061204019_1061204028 3 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204028 9:129152724-129152746 GTTGGGGAGGGGCAGCCAGCTGG No data
1061204019_1061204037 26 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204037 9:129152747-129152769 TTAGAATTTGGGGTGGTAGGGGG No data
1061204019_1061204025 -9 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204025 9:129152712-129152734 ACCGGGGTCTTTGTTGGGGAGGG No data
1061204019_1061204027 -8 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204027 9:129152713-129152735 CCGGGGTCTTTGTTGGGGAGGGG No data
1061204019_1061204035 24 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204035 9:129152745-129152767 GGTTAGAATTTGGGGTGGTAGGG No data
1061204019_1061204031 16 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204031 9:129152737-129152759 AGCCAGCTGGTTAGAATTTGGGG No data
1061204019_1061204036 25 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204036 9:129152746-129152768 GTTAGAATTTGGGGTGGTAGGGG No data
1061204019_1061204024 -10 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204024 9:129152711-129152733 CACCGGGGTCTTTGTTGGGGAGG No data
1061204019_1061204029 14 Left 1061204019 9:129152698-129152720 CCTGCCGTAGGGACACCGGGGTC No data
Right 1061204029 9:129152735-129152757 GCAGCCAGCTGGTTAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061204019 Original CRISPR GACCCCGGTGTCCCTACGGC AGG (reversed) Intergenic
No off target data available for this crispr