ID: 1061206508

View in Genome Browser
Species Human (GRCh38)
Location 9:129167038-129167060
Sequence CCCTTGGATGGGTGTGTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061206501_1061206508 1 Left 1061206501 9:129167014-129167036 CCATGTTCCGTCTTTGCTGAGGG No data
Right 1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG No data
1061206499_1061206508 2 Left 1061206499 9:129167013-129167035 CCCATGTTCCGTCTTTGCTGAGG No data
Right 1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG No data
1061206503_1061206508 -6 Left 1061206503 9:129167021-129167043 CCGTCTTTGCTGAGGGTCCCTTG No data
Right 1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG No data
1061206498_1061206508 25 Left 1061206498 9:129166990-129167012 CCTCACATAGCTTGGGATGCTCT No data
Right 1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG No data
1061206497_1061206508 26 Left 1061206497 9:129166989-129167011 CCCTCACATAGCTTGGGATGCTC No data
Right 1061206508 9:129167038-129167060 CCCTTGGATGGGTGTGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061206508 Original CRISPR CCCTTGGATGGGTGTGTTTG TGG Intergenic
No off target data available for this crispr