ID: 1061207602

View in Genome Browser
Species Human (GRCh38)
Location 9:129173891-129173913
Sequence CTGTGGTAAAGGAGAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061207602_1061207613 -4 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207613 9:129173910-129173932 ACAGGGATCCCTGGGGCGGGTGG No data
1061207602_1061207615 -2 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207615 9:129173912-129173934 AGGGATCCCTGGGGCGGGTGGGG No data
1061207602_1061207619 20 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207619 9:129173934-129173956 GAATTCCCAAGCCCTTTGGCCGG No data
1061207602_1061207618 16 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207618 9:129173930-129173952 TGGGGAATTCCCAAGCCCTTTGG No data
1061207602_1061207610 -8 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207610 9:129173906-129173928 TACCACAGGGATCCCTGGGGCGG No data
1061207602_1061207611 -7 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207611 9:129173907-129173929 ACCACAGGGATCCCTGGGGCGGG No data
1061207602_1061207614 -3 Left 1061207602 9:129173891-129173913 CCATCCACTCTCCTTTACCACAG No data
Right 1061207614 9:129173911-129173933 CAGGGATCCCTGGGGCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061207602 Original CRISPR CTGTGGTAAAGGAGAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr