ID: 1061207865

View in Genome Browser
Species Human (GRCh38)
Location 9:129174898-129174920
Sequence GGTCAGAGGGGAGCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061207854_1061207865 21 Left 1061207854 9:129174854-129174876 CCGGGCCTTGGCACATTCTCCCA No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data
1061207851_1061207865 24 Left 1061207851 9:129174851-129174873 CCCCCGGGCCTTGGCACATTCTC No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data
1061207855_1061207865 16 Left 1061207855 9:129174859-129174881 CCTTGGCACATTCTCCCACTCTG No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data
1061207853_1061207865 22 Left 1061207853 9:129174853-129174875 CCCGGGCCTTGGCACATTCTCCC No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data
1061207852_1061207865 23 Left 1061207852 9:129174852-129174874 CCCCGGGCCTTGGCACATTCTCC No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data
1061207857_1061207865 2 Left 1061207857 9:129174873-129174895 CCCACTCTGAGGTCATTCCGTAG No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data
1061207858_1061207865 1 Left 1061207858 9:129174874-129174896 CCACTCTGAGGTCATTCCGTAGG No data
Right 1061207865 9:129174898-129174920 GGTCAGAGGGGAGCGCGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061207865 Original CRISPR GGTCAGAGGGGAGCGCGCGC CGG Intergenic
No off target data available for this crispr