ID: 1061207964

View in Genome Browser
Species Human (GRCh38)
Location 9:129175285-129175307
Sequence GCCGCCCCGGGGTCTCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061207964_1061207977 7 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207977 9:129175315-129175337 CGTGGGGGACAGGACCCCCCTGG No data
1061207964_1061207979 13 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207979 9:129175321-129175343 GGACAGGACCCCCCTGGAGCGGG No data
1061207964_1061207982 18 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207982 9:129175326-129175348 GGACCCCCCTGGAGCGGGGGCGG No data
1061207964_1061207978 12 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207978 9:129175320-129175342 GGGACAGGACCCCCCTGGAGCGG No data
1061207964_1061207980 14 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207980 9:129175322-129175344 GACAGGACCCCCCTGGAGCGGGG No data
1061207964_1061207981 15 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207981 9:129175323-129175345 ACAGGACCCCCCTGGAGCGGGGG No data
1061207964_1061207970 -10 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207970 9:129175298-129175320 CCGGGGCGGCCAGTTCCCGTGGG No data
1061207964_1061207973 -3 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207973 9:129175305-129175327 GGCCAGTTCCCGTGGGGGACAGG No data
1061207964_1061207972 -8 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207972 9:129175300-129175322 GGGGCGGCCAGTTCCCGTGGGGG No data
1061207964_1061207971 -9 Left 1061207964 9:129175285-129175307 CCCGCTGGAGACCCCGGGGCGGC No data
Right 1061207971 9:129175299-129175321 CGGGGCGGCCAGTTCCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061207964 Original CRISPR GCCGCCCCGGGGTCTCCAGC GGG (reversed) Intergenic