ID: 1061208258

View in Genome Browser
Species Human (GRCh38)
Location 9:129176724-129176746
Sequence CAGCTCAGCCCCGAGTGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208248_1061208258 -5 Left 1061208248 9:129176706-129176728 CCTGCCCCCGCTCGCCCCCAGCT 0: 1
1: 1
2: 7
3: 96
4: 762
Right 1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 274
1061208250_1061208258 -10 Left 1061208250 9:129176711-129176733 CCCCGCTCGCCCCCAGCTCAGCC 0: 1
1: 1
2: 5
3: 63
4: 491
Right 1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 274
1061208247_1061208258 -2 Left 1061208247 9:129176703-129176725 CCGCCTGCCCCCGCTCGCCCCCA 0: 1
1: 0
2: 4
3: 128
4: 1021
Right 1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 274
1061208249_1061208258 -9 Left 1061208249 9:129176710-129176732 CCCCCGCTCGCCCCCAGCTCAGC 0: 1
1: 0
2: 6
3: 61
4: 380
Right 1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208258 Original CRISPR CAGCTCAGCCCCGAGTGGCC CGG Exonic
900129492 1:1081399-1081421 CAGCTCAGCCCTCTCTGGCCAGG + Intergenic
900155845 1:1202989-1203011 CAGCTCAGCTCCCAGTGGGGCGG - Intergenic
900389549 1:2428028-2428050 CAGCTCCGGGCCGAGTGCCCAGG - Intronic
900778106 1:4599800-4599822 CAGCTCAGCACCGTGGGGACAGG + Intergenic
900952407 1:5865397-5865419 CAGCTCTGCCTCCTGTGGCCTGG - Intronic
901021138 1:6256481-6256503 TGCCTCAGCCCCGAGTGGCTGGG + Intronic
901814782 1:11787905-11787927 CAGCTCTGGCCACAGTGGCCTGG + Exonic
901876025 1:12167455-12167477 CTGCTCAGCCCCAAATGCCCCGG - Intronic
903943280 1:26946198-26946220 CAGCTCAGCCCCAAGAGTTCAGG - Exonic
905304818 1:37010197-37010219 CAGCTGAGCAAGGAGTGGCCCGG - Intronic
905409189 1:37756550-37756572 TAGCTCAGCTCCCACTGGCCTGG + Intronic
907054613 1:51353688-51353710 CACCTCAGCCCCCAGTAGCTGGG + Intergenic
907358264 1:53894138-53894160 CAGCTCCGCCCAGTGTTGCCTGG + Intronic
909063726 1:70907870-70907892 CAGCTCCACCCAGGGTGGCCAGG + Intronic
910209456 1:84778342-84778364 CAGCTCAGCATCAAGTGACCAGG + Intergenic
912413523 1:109493484-109493506 CTGCTCAGCCCTGAGGAGCCAGG - Intergenic
913283225 1:117205268-117205290 CACCTCAGTCCCGAGTAGCTGGG + Intronic
915839987 1:159205811-159205833 CAGCTCTGCCCTGTGTAGCCTGG + Exonic
917286495 1:173426706-173426728 CACCTCGGCCCCGAGTAGCTGGG + Intergenic
919490218 1:198197626-198197648 CTGTTCAGCCCTGAGTGGCTAGG - Intronic
920411615 1:205765950-205765972 CACCTCAGCCTCGAGTAGCTGGG - Intergenic
921214920 1:212928580-212928602 CAGCTCAGCCTGGAATGTCCTGG - Intergenic
922000447 1:221472601-221472623 TACCTCAGCCCCGAGTAGCTGGG + Intergenic
922416965 1:225431026-225431048 CACCTCAGCCCCGAGTAGCTGGG + Intergenic
923238940 1:232061982-232062004 GAACTCAGCCCCCAGTGGCCTGG - Intergenic
924470208 1:244336666-244336688 CACCTCAGCCCTGGGAGGCCTGG + Intergenic
924478524 1:244404707-244404729 CAGCCCCGCCCCGAGTAGCTGGG + Intergenic
1067076003 10:43182759-43182781 CATCTCAGCCCCGAGTAGCTGGG - Intronic
1067404371 10:46007882-46007904 CAACTTAGCCACCAGTGGCCAGG - Intronic
1067407349 10:46034888-46034910 CACCTCAGCCCCAAGTAGCTGGG - Intronic
1067434091 10:46265134-46265156 GAGCTCAGGTCCGACTGGCCAGG - Intergenic
1069861063 10:71472109-71472131 CAGCCCTGCTCCGAGTGGCGGGG + Intronic
1073129146 10:101175465-101175487 CACCTCAGCCCCAGGTGGCTAGG + Intergenic
1075738979 10:124681894-124681916 AGGCTCAGCCCCGTGTGGACAGG - Exonic
1076035631 10:127196590-127196612 CACCTCCGCCCCGCGGGGCCCGG - Intronic
1076061497 10:127417323-127417345 CAGCTCAGCCCTAAGGTGCCAGG - Intronic
1077105327 11:839756-839778 TGCCTCAGCCCCGAGTGGCCGGG + Exonic
1077431003 11:2515968-2515990 CAGCCCAGACCCCAGGGGCCGGG + Intronic
1077432334 11:2522039-2522061 CATCTCAGCCCCGGGTGCCCGGG - Intronic
1077437146 11:2548175-2548197 CAGCTCAGACCCGAGGTCCCAGG + Intronic
1079031562 11:16990006-16990028 CAGCTCAGCCTCTAGTCTCCAGG - Intronic
1081926981 11:46838678-46838700 CACCTCAGCCTCTAGTGGCTGGG - Intronic
1083160525 11:60851484-60851506 CTGCCCAGCCCCATGTGGCCTGG + Exonic
1083163033 11:60867419-60867441 CACCACAGCCCCTGGTGGCCAGG + Intergenic
1083419909 11:62546787-62546809 CAGAGCAGCTCCGAGTGGCCGGG + Exonic
1084897673 11:72286341-72286363 CACCTCAGCCTCGAGTAGCTGGG + Intergenic
1085580895 11:77649528-77649550 CACCTCAACCCCAAGTAGCCGGG + Intergenic
1086049785 11:82576962-82576984 CAGCCCACCCAGGAGTGGCCTGG + Intergenic
1086683080 11:89699003-89699025 CCTCTCAGCCCAGGGTGGCCAGG - Intergenic
1086933370 11:92718088-92718110 AAGCTCAGCCCCAAGAGACCTGG + Intronic
1089180490 11:116580051-116580073 CAACACAGCCCCGGGTGGGCAGG + Intergenic
1089313756 11:117576770-117576792 CAGCTGTGCCCCGAGTGTCAGGG + Intronic
1090929556 11:131283348-131283370 CACCTCAGCCCCCAGTAGCCTGG - Intergenic
1090949983 11:131464684-131464706 CAGCAGTGCCCCGAGGGGCCAGG + Intronic
1091003601 11:131931996-131932018 CAGCTAAGCCCAGAGCAGCCAGG + Intronic
1091793142 12:3282971-3282993 GACCTCAGCCCCGAGAGGCTTGG - Intronic
1093452821 12:19335145-19335167 CAGCCCTGCCCCGAGTAGCTGGG + Intronic
1095480092 12:42625725-42625747 CAGCTGAGCCCTGATTGGCTGGG + Intergenic
1096841000 12:54379172-54379194 CCGCACAGCCCCGAGCCGCCCGG - Intronic
1098234202 12:68402689-68402711 CAGCTGAGCCCTGATTGGCGGGG - Intergenic
1098486139 12:71024160-71024182 CACCTCAGCCCCAAGTAGCTAGG + Intergenic
1101574611 12:105986076-105986098 CAGCTCAGCTCTGGGTGGCCAGG + Intergenic
1101957365 12:109223042-109223064 CAGTTCAGCCCAATGTGGCCAGG + Intronic
1104060829 12:125266882-125266904 CAGCCCAGCCCAGAGTGCCATGG - Intronic
1104210722 12:126685806-126685828 CAACTCAGCCCAGTGAGGCCTGG + Intergenic
1106303907 13:28494314-28494336 CAGCCCAGCCCCGGGCAGCCTGG + Intronic
1107515882 13:41128907-41128929 CACCTCAGCCCCGAGTTGCTAGG + Exonic
1110574730 13:77042307-77042329 CACCTCAGCCCCAAGTAGCTGGG - Intergenic
1113553387 13:111211153-111211175 CACAGCAGCCCCGAGAGGCCTGG + Intronic
1113876457 13:113597733-113597755 CAGATCAGCCCCTCGTGGCTGGG - Intronic
1114007248 14:18328014-18328036 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1119053627 14:71395545-71395567 CACCTCAGCCCCCAGTAGCTGGG - Intronic
1122775749 14:104116423-104116445 CAGCCCAGCCCCGAACGTCCTGG - Intergenic
1122917159 14:104864669-104864691 CAGCTCAGCCCAGAGCGCCCGGG + Intergenic
1123391165 15:19874669-19874691 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1123495318 15:20817345-20817367 CAGCGCAGCTCCTAGTGGGCGGG + Intergenic
1123551807 15:21386438-21386460 CAGCGCAGCTCCTAGTGGGCGGG + Intergenic
1124271067 15:28281357-28281379 CAGCACAGCTCCCAGTGGCGAGG + Intronic
1124962143 15:34406706-34406728 CAGCACAGCCCAGGGTGCCCGGG - Intronic
1124978766 15:34552927-34552949 CAGCACAGCCCAGGGTGCCCGGG - Intronic
1125636445 15:41192726-41192748 CACCTCAGCCTCGAGTAGCTAGG + Intronic
1127398974 15:58566228-58566250 CAGCACAGCCCCAAGTGTACGGG - Intronic
1128004889 15:64229573-64229595 CAGCTCAGCCTGGAGTTGCCAGG + Intronic
1128355094 15:66920737-66920759 CATTTCAGCCCCTGGTGGCCAGG - Intergenic
1128499405 15:68217343-68217365 CAGCTCAGTCCTGAGTAGCTGGG + Intronic
1130655964 15:85792428-85792450 CAGCTCTGCCCACACTGGCCAGG + Intronic
1131918859 15:97301415-97301437 CAGCTCAGCCACAAGGGGCAGGG + Intergenic
1202960152 15_KI270727v1_random:113680-113702 CAGCGCAGCTCCTAGTGGGCGGG + Intergenic
1132496371 16:265318-265340 CAGCTCTGCCCAAGGTGGCCAGG - Exonic
1132548889 16:546118-546140 GCGCTCAGCCCCGCGTGGCGAGG - Intronic
1132646048 16:999796-999818 CAGCTCAGCCAGCAGGGGCCAGG + Intergenic
1133281875 16:4671251-4671273 CAGCTCAACCCCTGGGGGCCAGG - Intronic
1133283732 16:4681087-4681109 CAGGTCAGCCCCCAGAGGCCCGG + Intronic
1134403744 16:13937033-13937055 CACATCAGCCCCAAGTGGCTGGG + Intronic
1135322975 16:21509119-21509141 CATTTCAGCACCGGGTGGCCTGG - Intergenic
1139585947 16:67903716-67903738 CAGCTCAGCGGCAAGTGGTCAGG - Intronic
1140096993 16:71883907-71883929 CAGCGCAGCGCCGAGGCGCCGGG - Exonic
1140432349 16:74915158-74915180 CAGCACAGCACAGAGTGCCCTGG + Intronic
1141054909 16:80804942-80804964 CCGCGCAGCCCCGAGGGGCCAGG - Intergenic
1141635945 16:85313768-85313790 CAGCTCAGCCCAGGCTGGCGGGG - Intergenic
1141995605 16:87634789-87634811 GGCCTCAGCCCCGAGTGGGCAGG + Intronic
1142035167 16:87858139-87858161 CATTTCAGCACCGGGTGGCCTGG - Intronic
1142837061 17:2594496-2594518 CGGCTCAGCCCCGCGCCGCCGGG + Intronic
1145126256 17:20302350-20302372 CAGCTCAGCCCACAGGAGCCGGG - Intronic
1146649482 17:34597842-34597864 GATCTCAGCCCCCAGTGACCAGG - Intronic
1147373490 17:40010396-40010418 CAGCTCAGCCCCATGTGTCATGG + Intergenic
1147409058 17:40236075-40236097 CAGCACCGCCCCGAGTTGCTGGG + Intronic
1147586103 17:41654828-41654850 CTGCCCAGCCCCGTGAGGCCGGG + Intergenic
1148675290 17:49441385-49441407 CAGCTCGCTCCAGAGTGGCCTGG + Intronic
1148713951 17:49702232-49702254 CACCTCAGCCCCGAGTAGCTGGG + Intronic
1149519782 17:57310039-57310061 CAGTTCAGACCCGGCTGGCCTGG + Intronic
1151312522 17:73302588-73302610 CACCTCAGTCCCGAGTAGCTGGG + Intronic
1151397248 17:73831666-73831688 CACCTCAGGTCCTAGTGGCCTGG - Intergenic
1151428898 17:74049437-74049459 AAGCTCAGGCCTGAGGGGCCAGG - Intergenic
1152531789 17:80923201-80923223 CAGCTCAGAGTCGAGTGGGCCGG - Intronic
1152550935 17:81029796-81029818 CACCTCAGCCTCTAGTGGCTAGG + Intergenic
1154530219 18:15335977-15335999 CACCTCAGCCCAGAGTAGCTGGG + Intergenic
1156781710 18:40858102-40858124 TGCCTCAGCCCCGAGTGGCTGGG - Intergenic
1157499652 18:48180557-48180579 CAGCACAGCCCCAAGGGCCCAGG + Intronic
1157695643 18:49721204-49721226 CAGCTCATCTGCAAGTGGCCAGG + Intergenic
1157825501 18:50808570-50808592 CACCTCAGCCCTGAGTAGCTGGG + Intronic
1158907807 18:62030894-62030916 CACCTCAGCCTCGAGTAGCTGGG - Intergenic
1160492418 18:79349426-79349448 CAGCTCAGACCTGAGTTGTCAGG + Intronic
1160839636 19:1140384-1140406 TGGCTCAGCCCCGTGTGTCCTGG - Intronic
1161361387 19:3852051-3852073 CAGCTGAGCCCCGCCTGGCCAGG - Intronic
1161361440 19:3852248-3852270 CAGCTGAGCCCCATCTGGCCAGG - Intronic
1161500425 19:4611518-4611540 CAGCTCAGGCCCGGGTGGAGGGG - Intergenic
1161508013 19:4654455-4654477 CACCTCAGCCCCGGGTAGCTGGG + Exonic
1161610075 19:5237607-5237629 CCGTTCAGCCCAGAGTGGCTGGG + Intronic
1161673310 19:5626795-5626817 TACCACAGCCCCGAGTCGCCTGG - Intronic
1162109666 19:8393335-8393357 CAGGTGAGCCCTGATTGGCCAGG - Intronic
1162110056 19:8395168-8395190 CATCTTGGCCCCCAGTGGCCTGG + Intronic
1163235990 19:16031087-16031109 AAGCTCAGCCTCGAGGGTCCTGG + Intergenic
1165070282 19:33251519-33251541 CAGGGCAGCCCCGATGGGCCAGG - Intergenic
1165454637 19:35903582-35903604 CCGCACAGCCCCGAGGGTCCTGG + Intronic
1165530084 19:36391578-36391600 CACCTCAGCCTCGAGTAGCTAGG + Intronic
1167300138 19:48673226-48673248 CAGGACAGCCCCGAGCAGCCTGG + Intergenic
1167586821 19:50380058-50380080 CTCCTCAGCCTCGAGTGGCTGGG - Intronic
1167811600 19:51837325-51837347 CAGCTGAGCGCTGATTGGCCAGG + Intergenic
1168100452 19:54138407-54138429 CACCTGAGCCCCGAGAGGGCGGG - Intronic
1168710770 19:58498765-58498787 CAGGTGAGCCCAGGGTGGCCTGG - Exonic
1168728770 19:58607380-58607402 CAGGTCAGACCCGGGTGGGCGGG + Intergenic
925971292 2:9108314-9108336 CTGCTCAGACCCCAGAGGCCTGG + Intergenic
927146267 2:20168482-20168504 CAGCCCAGCCCTGGGTGGACAGG + Intergenic
927948928 2:27154549-27154571 CATCCCAGCCCCGAGCTGCCTGG + Exonic
928410433 2:31050064-31050086 CACCAAAGCCCCGAGTGGCCAGG - Intronic
929836767 2:45409106-45409128 CACCTCAGCCCCAAGTAGCTGGG - Intronic
930775735 2:55168331-55168353 CAGCCAAGCCACGAGGGGCCTGG + Intergenic
931600950 2:64001978-64002000 CACCTCAGCCCACAGTGGCAAGG + Intronic
932615581 2:73229231-73229253 CACCTCAGCCTCGAGTAGCTGGG + Intronic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
938529320 2:132167436-132167458 CACCTCAGCCCAGAGTAGCTGGG + Intronic
938956001 2:136298914-136298936 CAGTTCAGCCCGGAGTGGGGCGG + Intergenic
941282107 2:163565332-163565354 CAGCTCATCTCAGAGTGTCCTGG - Intergenic
941934288 2:170971164-170971186 CAGCTCTGCCCAGGCTGGCCTGG + Intergenic
942678825 2:178455445-178455467 CAGCTCAGCCCCAAGAGTTCAGG - Intronic
944540015 2:200745785-200745807 AGGCTCAGCCCCGGGTGGCCGGG + Intergenic
948178024 2:235959481-235959503 GAGCTCAGCGCCCAGTGGACGGG + Intronic
948454809 2:238100028-238100050 CACAGGAGCCCCGAGTGGCCTGG - Intergenic
948733202 2:239980140-239980162 CAGCTCACCTCCTAGTGGGCAGG - Intronic
948803072 2:240441586-240441608 CAGCACAGCCCTGTGGGGCCCGG + Intronic
948809213 2:240466363-240466385 CACCTCAGCCTGGAGAGGCCTGG + Exonic
1169043007 20:2511222-2511244 CACCTCAGCCCCGAGTAGTTGGG + Intronic
1169420499 20:5455213-5455235 CACCTCAGCCTCGAGTAGCTAGG + Intergenic
1175215881 20:57391534-57391556 GAGCGCAGCCCCGCGCGGCCCGG + Exonic
1175358662 20:58389680-58389702 CAGAACTGCCCGGAGTGGCCGGG + Intronic
1175967213 20:62665696-62665718 GAGGTCAGCCCAGAGGGGCCAGG - Intronic
1176022070 20:62967042-62967064 CAGCTCAGCCTCGCCTGGGCCGG + Intronic
1176095587 20:63342775-63342797 CACCTCTGCCCCGCGTTGCCTGG - Intergenic
1176364059 21:6021916-6021938 CAGCTCAGGCCTATGTGGCCTGG - Intergenic
1176767190 21:13032481-13032503 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1177222124 21:18208876-18208898 CAGCTCAGCACAGAGGGGCGGGG - Intronic
1178485877 21:33020016-33020038 CTGCGCAGCCCCGCGGGGCCGGG + Intergenic
1179759459 21:43516629-43516651 CAGCTCAGGCCTATGTGGCCTGG + Intergenic
1180431755 22:15258821-15258843 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1180514313 22:16126744-16126766 CACCTCAGCCCAGAGTAGCTGGG - Intergenic
1181669045 22:24417447-24417469 CAGCACATCACCGTGTGGCCTGG + Exonic
1182280540 22:29215600-29215622 CAGCTCACTCCTGAGTGCCCAGG - Exonic
1182331341 22:29553513-29553535 CAGCGCAGCGCCGAGAGGCCGGG + Intronic
1182419804 22:30243484-30243506 CAGCCCAGCCCAGAGTGGAGTGG + Exonic
1183531009 22:38353347-38353369 CAGCCCCGCCCCGCGTGACCAGG - Intronic
1183573977 22:38675254-38675276 CAGCTCAGCCCTGTGTAGCAGGG + Intergenic
1184035188 22:41914802-41914824 GACCCCAGCCCCGAGTGGGCTGG + Intergenic
1184405285 22:44297414-44297436 CTGCTCAGCCCAGGCTGGCCCGG + Intronic
1184657280 22:45948197-45948219 CAGCTCAGCGCTGAGGGGCCAGG + Intronic
1184997804 22:48223223-48223245 CAGCTCAGCCTCGATTGCTCGGG - Intergenic
1185116178 22:48939637-48939659 TAGCTCAGCCCCCACAGGCCGGG + Intergenic
1185205448 22:49535617-49535639 CAGCTCAGACACAGGTGGCCAGG + Intronic
1185255066 22:49827399-49827421 CACCACAACCCCGAGAGGCCGGG + Intronic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
949980965 3:9501465-9501487 CTGCTCAGCCCGGGCTGGCCTGG - Exonic
950208335 3:11096980-11097002 CAGCTTAGCCCCCAGTGTCTGGG - Intergenic
950743489 3:15068294-15068316 CACCTCAGCCCCGAGTAGCTTGG + Intergenic
951838787 3:27011302-27011324 TAGCTCAGCCTCGAGTAGCAGGG + Intergenic
952309086 3:32170856-32170878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
953024310 3:39135937-39135959 CAGCCCACCCCCGAGTAGCTGGG - Intronic
953484915 3:43286388-43286410 CGCCTCAGCCCCGACTCGCCGGG + Intergenic
954216823 3:49129302-49129324 TGGCTCAGGCCCCAGTGGCCAGG + Exonic
954251809 3:49373564-49373586 CATCTCAGCCCCAAGTGGCTGGG - Intronic
954440312 3:50518165-50518187 CAGCTCATCCTGGTGTGGCCTGG + Intergenic
954779674 3:53049802-53049824 CGCCTCAGCCCCGAGTAGCTGGG + Intronic
959398186 3:105868373-105868395 CAGCTCAGACCCGAGGGGCCGGG - Intronic
961166412 3:124766755-124766777 GCTCTCAGCCCCAAGTGGCCTGG - Intronic
962168603 3:133077165-133077187 CAGCACAGCCCCAAACGGCCAGG - Intronic
962715784 3:138124894-138124916 CAAATCAGCCCCAAGTAGCCAGG + Intronic
963891565 3:150641280-150641302 CACCCCAACCCCGAGTGGCTGGG - Intergenic
966209081 3:177434284-177434306 CAGCACAGCCACGTGTGCCCAGG + Intergenic
968110704 3:196044476-196044498 CACCTCAGCCTCGAGTTGCTGGG - Intronic
968239953 3:197070360-197070382 CATCTTAGCCCAGAGTGGCTGGG + Intronic
968382787 4:109799-109821 CAGCTGAGCCTCTAGTGGCCGGG + Intergenic
968596826 4:1490113-1490135 CAGCTCAGGCCTCAGTGTCCTGG + Intergenic
968799045 4:2730016-2730038 CACCTCAGCCCCGAGCAGCTGGG + Intronic
968860874 4:3168760-3168782 CACCTCAGCCCCGAGTAGCTGGG - Intronic
968900569 4:3429759-3429781 CTCCACAGCCCCGAGGGGCCAGG - Intronic
972712348 4:41610008-41610030 AAGCACAGCCCTGGGTGGCCTGG + Intronic
975123066 4:70750125-70750147 TACCTCAGCCCCGAGTAGCTAGG + Intronic
975344302 4:73276617-73276639 CAGCCCAGCCTGGAGTGCCCTGG + Intergenic
975365675 4:73524728-73524750 CACTTCAGCCCCAAGTGGCAAGG + Intergenic
975658716 4:76667430-76667452 CACCTCAGCCCTGAGTAGCTGGG + Intronic
976725290 4:88210301-88210323 CACCTCAGCCTCCAGTGGCTGGG + Intronic
979158611 4:117429738-117429760 CAGGTCAGCCCCGAGTGGTCTGG - Intergenic
982091466 4:151883550-151883572 CAGCTCAGCCCTGAGGAGACAGG - Intergenic
984978733 4:185256737-185256759 CACCTCAGCCCCAAGTAGCTGGG + Intronic
985635379 5:1033249-1033271 CAGCTCAGGCCCGTCTGGACAGG + Intronic
989373983 5:40740598-40740620 CAGCTCATTCCCGAGGGGCATGG + Intronic
993363227 5:87003497-87003519 CAGCTCAGCCACAAGTGAACTGG - Intergenic
996597561 5:125222857-125222879 CAGCTCAACCCCGGCTGGACAGG - Intergenic
996728376 5:126692862-126692884 CACCTCAGCCCCAAGTAGCTGGG + Intergenic
996877429 5:128254796-128254818 CAGCTGAGCCCTGATTGGCCAGG + Intergenic
997233495 5:132259507-132259529 CAGCTCAGGCCCAAGGAGCCAGG + Intronic
997337388 5:133117785-133117807 GGGCTGAGCCCCGGGTGGCCTGG + Intergenic
997359507 5:133285777-133285799 CAGCTCAGCACCACCTGGCCCGG + Intronic
998864128 5:146477809-146477831 CACCTCAGCCCTGAGTAGCTGGG + Intronic
999225195 5:150016225-150016247 CACCTCAGCCCTGAGTAGCTGGG - Intronic
1001041899 5:168342186-168342208 CAGCTCACCTCCAACTGGCCTGG + Intronic
1001506441 5:172283920-172283942 CGGCTCAGCCCCGCCAGGCCAGG + Exonic
1002494127 5:179600247-179600269 GAGCTCGGGCCCGAGTGGCGGGG - Intronic
1006407964 6:33856131-33856153 CAGCGCAGCCCTGAGGTGCCAGG + Intergenic
1007586824 6:42995827-42995849 CCCCTCAGCCCCGAGTAGCTGGG + Intronic
1007662392 6:43494933-43494955 CAGCTCAGCATCCAGAGGCCAGG + Intronic
1009431730 6:63572915-63572937 CCCCGCAGCCCCGAGGGGCCCGG - Intronic
1011083650 6:83515615-83515637 CAACTCAGCCCAGAGTAGCTGGG + Intronic
1012470511 6:99568387-99568409 CAGCTCAGTTCCGAGTGCCGGGG - Intronic
1013241283 6:108248170-108248192 CAGGTCTGCCCTGAGGGGCCAGG - Intronic
1016573291 6:145538984-145539006 CAGCTCAACCCTCAGAGGCCAGG + Intronic
1017486485 6:154906703-154906725 TGCCTCAGCCCCGAGTAGCCGGG - Intronic
1018303270 6:162426562-162426584 CACCTCATCCCCAAGTGGCTGGG + Intronic
1018349566 6:162942969-162942991 CAGCTCAGCTGGGATTGGCCAGG + Intronic
1019190451 6:170247740-170247762 CAGCTCAGCTCCCAGGGGCTGGG + Intergenic
1019342352 7:514511-514533 CAGCCCAGGCCCAGGTGGCCTGG + Intronic
1019525708 7:1479560-1479582 CAGGGCAGCCCCGAGGTGCCGGG - Exonic
1020007795 7:4791587-4791609 CAGCTCAGCTCAGTGTTGCCTGG - Exonic
1020172019 7:5852374-5852396 GAGCTCAGAACCCAGTGGCCTGG - Intergenic
1025195091 7:56926418-56926440 CAGCTCAGCCCAGAGTGGAGAGG + Intergenic
1025676861 7:63650525-63650547 CAGCTCAGCCCAGAGTGGAGAGG - Intergenic
1026899189 7:74027736-74027758 CAGCCAAGGCCCGAGTGGCCAGG - Intergenic
1027493086 7:78855200-78855222 CACCTCAGCCCCAAGTAGCTGGG + Intronic
1029086650 7:98017131-98017153 GAGCTCAGAACCCAGTGGCCTGG + Intergenic
1029644356 7:101844058-101844080 CAGCTGAGCCCTGATTGGCCAGG - Intronic
1029673379 7:102049332-102049354 CAGCTCAGCCCGGAGGGGAGAGG + Intronic
1030186746 7:106769856-106769878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
1033588486 7:142791804-142791826 CAGCTCAGCTCCACGTGGTCAGG - Intergenic
1033589987 7:142801151-142801173 CAGCTCAGCTCCACGTGGTCGGG - Intergenic
1035102943 7:156416310-156416332 CCGCTCAGCCCCGACTGTCTGGG + Intergenic
1035170677 7:157015648-157015670 AAGCTGAGCCCAGGGTGGCCAGG - Intergenic
1035272771 7:157730195-157730217 CAGCTTCACCCCGAGTGCCCGGG - Intronic
1035397368 7:158543988-158544010 CAGGGCAGCCCCAACTGGCCGGG + Intronic
1035449724 7:158968865-158968887 CACCCCAGCCCCGAGTAGCTGGG - Intergenic
1036783000 8:11662885-11662907 CAGGCCAGCTCCGGGTGGCCTGG + Intergenic
1037312514 8:17571761-17571783 CACCTTAGCCCCGAGTAGCTGGG - Intergenic
1038488893 8:27955434-27955456 CTGTGCAGCCCAGAGTGGCCCGG - Intronic
1038917472 8:32039906-32039928 CACCTCAGCCCCAAGTAGCTTGG - Intronic
1039455563 8:37703714-37703736 CAGTTCAGTCTCCAGTGGCCCGG + Intergenic
1039887836 8:41665259-41665281 AGGCTCTGCCCTGAGTGGCCCGG + Intronic
1040517861 8:48148950-48148972 AACCTCAGCCCCGAGTAGCTGGG - Intergenic
1040610654 8:48978313-48978335 CAGCTGAGGCCCCAGAGGCCCGG - Intergenic
1043769955 8:84184907-84184929 CAGCTCCGGCTCGCGTGGCCTGG - Exonic
1044684599 8:94814778-94814800 CAACTCATCCCCGCTTGGCCAGG - Intronic
1045063848 8:98428517-98428539 CTGCTCAGCACTGAGTAGCCGGG - Exonic
1045385515 8:101667924-101667946 CAGCTCAGCTCTGAGTCGGCAGG + Exonic
1045725238 8:105165152-105165174 CAGCACAGGCCTCAGTGGCCGGG - Intronic
1046071636 8:109262545-109262567 CAGCTGAGCCCTGATTGACCAGG - Intronic
1047694920 8:127393941-127393963 CCTCTCAGCACCCAGTGGCCAGG + Intergenic
1048244197 8:132775596-132775618 CAGCTCGGCCCCGGACGGCCCGG + Exonic
1049201341 8:141342016-141342038 CAACTGTGCCCAGAGTGGCCTGG - Intergenic
1049401244 8:142428317-142428339 CCGCTCAGCCCTGGGTGGCTGGG - Intergenic
1049447279 8:142637089-142637111 CAGCTCAGCTCAGAGGGGCTGGG + Intergenic
1049619753 8:143592732-143592754 CAGGTCAGCCCGGGGCGGCCGGG + Intronic
1049651204 8:143770877-143770899 CAGCGCTGCCCTGACTGGCCTGG - Intergenic
1049897059 9:118165-118187 CAGCTCAGCCCGCCGGGGCCAGG - Exonic
1050590357 9:7154126-7154148 CAGCTCAGCCCCCATTAGACTGG + Intergenic
1054417831 9:64894499-64894521 CACCTCAGCCCAGAGTAGCTGGG + Intergenic
1057706718 9:97399935-97399957 CAGCACAGCCTTGAGAGGCCAGG - Intergenic
1059787152 9:117598246-117598268 TAGCTCAGCCCCAAGGGGCAGGG - Intergenic
1060725091 9:126001158-126001180 CGGGGAAGCCCCGAGTGGCCAGG + Intergenic
1060831360 9:126719739-126719761 CAACCCAGCCCAGAGTGGGCAGG + Intergenic
1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG + Exonic
1061397964 9:130353762-130353784 CAGCTCAGCCCTGAGGGGCTTGG + Intronic
1062178747 9:135179285-135179307 CAGCTGGCCCCCGTGTGGCCTGG - Intergenic
1062342569 9:136100300-136100322 CAGCTTAGCCCCCAGTCGCAAGG - Intergenic
1185463986 X:344638-344660 CAGCGCCGGCCCGTGTGGCCTGG - Intronic
1188485409 X:30676183-30676205 TGCCTCAGCCCCGAGTGGCTAGG + Intronic
1191861146 X:65667538-65667560 CCGCCCAGCCCCGCCTGGCCAGG - Intronic
1193971654 X:88062851-88062873 CAAATCAGCTCCGAGTGGCAAGG + Intergenic
1197216489 X:123871554-123871576 CAGCCCAGGCTGGAGTGGCCAGG + Intronic
1197800200 X:130340027-130340049 CAGCCCGGCCCCGCGCGGCCTGG - Intronic
1198466615 X:136909639-136909661 CACCTCAGCCCGGAGAGGGCGGG - Intergenic
1200217001 X:154372310-154372332 CCCCTCAGCCCAGCGTGGCCAGG + Intronic