ID: 1061208905

View in Genome Browser
Species Human (GRCh38)
Location 9:129179428-129179450
Sequence GGTCCAGATAGAGCGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208905_1061208915 13 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208915 9:129179464-129179486 GGGGCTGGTTGCTGCTCCCAGGG No data
1061208905_1061208909 -7 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208909 9:129179444-129179466 CTGGACCAAGAGGCCTGAAGGGG No data
1061208905_1061208907 -9 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208907 9:129179442-129179464 ATCTGGACCAAGAGGCCTGAAGG No data
1061208905_1061208916 14 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208916 9:129179465-129179487 GGGCTGGTTGCTGCTCCCAGGGG No data
1061208905_1061208910 -6 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208910 9:129179445-129179467 TGGACCAAGAGGCCTGAAGGGGG No data
1061208905_1061208920 30 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208920 9:129179481-129179503 CCAGGGGTTTCAAAGGTGCCTGG No data
1061208905_1061208912 -2 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208912 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
1061208905_1061208914 12 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208914 9:129179463-129179485 GGGGGCTGGTTGCTGCTCCCAGG No data
1061208905_1061208908 -8 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208908 9:129179443-129179465 TCTGGACCAAGAGGCCTGAAGGG No data
1061208905_1061208917 23 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208917 9:129179474-129179496 GCTGCTCCCAGGGGTTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208905 Original CRISPR GGTCCAGATAGAGCGCCCCC AGG (reversed) Intergenic
No off target data available for this crispr