ID: 1061208907

View in Genome Browser
Species Human (GRCh38)
Location 9:129179442-129179464
Sequence ATCTGGACCAAGAGGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208905_1061208907 -9 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208907 9:129179442-129179464 ATCTGGACCAAGAGGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208907 Original CRISPR ATCTGGACCAAGAGGCCTGA AGG Intergenic
No off target data available for this crispr