ID: 1061208910

View in Genome Browser
Species Human (GRCh38)
Location 9:129179445-129179467
Sequence TGGACCAAGAGGCCTGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208905_1061208910 -6 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208910 9:129179445-129179467 TGGACCAAGAGGCCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208910 Original CRISPR TGGACCAAGAGGCCTGAAGG GGG Intergenic
No off target data available for this crispr