ID: 1061208911

View in Genome Browser
Species Human (GRCh38)
Location 9:129179449-129179471
Sequence CCAGCCCCCTTCAGGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208911_1061208922 11 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208922 9:129179483-129179505 AGGGGTTTCAAAGGTGCCTGGGG No data
1061208911_1061208925 16 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208925 9:129179488-129179510 TTTCAAAGGTGCCTGGGGTGGGG No data
1061208911_1061208914 -9 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208914 9:129179463-129179485 GGGGGCTGGTTGCTGCTCCCAGG No data
1061208911_1061208916 -7 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208916 9:129179465-129179487 GGGCTGGTTGCTGCTCCCAGGGG No data
1061208911_1061208915 -8 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208915 9:129179464-129179486 GGGGCTGGTTGCTGCTCCCAGGG No data
1061208911_1061208917 2 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208917 9:129179474-129179496 GCTGCTCCCAGGGGTTTCAAAGG No data
1061208911_1061208924 15 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208924 9:129179487-129179509 GTTTCAAAGGTGCCTGGGGTGGG No data
1061208911_1061208920 9 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208920 9:129179481-129179503 CCAGGGGTTTCAAAGGTGCCTGG No data
1061208911_1061208926 17 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208926 9:129179489-129179511 TTCAAAGGTGCCTGGGGTGGGGG No data
1061208911_1061208923 14 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208923 9:129179486-129179508 GGTTTCAAAGGTGCCTGGGGTGG No data
1061208911_1061208921 10 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208921 9:129179482-129179504 CAGGGGTTTCAAAGGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208911 Original CRISPR CCAGCCCCCTTCAGGCCTCT TGG (reversed) Intergenic
No off target data available for this crispr